Incidental Mutation 'R7344:Cep41'
ID570079
Institutional Source Beutler Lab
Gene Symbol Cep41
Ensembl Gene ENSMUSG00000029790
Gene Namecentrosomal protein 41
SynonymsTsga14, 2810431D15Rik, 1700017E11Rik, Cep41
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location30653457-30693749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30693656 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 5 (R5K)
Ref Sequence ENSEMBL: ENSMUSP00000031810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031810] [ENSMUST00000115130] [ENSMUST00000115131] [ENSMUST00000140211] [ENSMUST00000140252] [ENSMUST00000169422]
Predicted Effect probably benign
Transcript: ENSMUST00000031810
AA Change: R5K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031810
Gene: ENSMUSG00000029790
AA Change: R5K

DomainStartEndE-ValueType
RHOD 151 263 9.88e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115130
AA Change: R5K

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000115131
AA Change: R5K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110784
Gene: ENSMUSG00000029790
AA Change: R5K

DomainStartEndE-ValueType
RHOD 151 263 1.62e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140211
AA Change: R5K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000140252
Predicted Effect probably benign
Transcript: ENSMUST00000169422
AA Change: R5K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a centrosomal protein which may be required for tubulin glutamylation in cilia during ciliogenesis. Mutations in a similar gene in human have been associated with Joubert Syndrome 15, an autosomal recessive ciliopathy and neurological disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous disruption of this gene causes an abnormal gait, increased thermal nociceptive threshold, and alterations in fertility/fecundity and eye morphology. Some embryos homozygous for a gene trapped allele die at E10-E12 exhibiting turning failure, dilated pericardial sacs, and brain anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Cep41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cep41 APN 6 30660967 missense probably benign 0.29
IGL02640:Cep41 APN 6 30658868 missense probably benign 0.00
PIT4480001:Cep41 UTSW 6 30658413 missense probably damaging 1.00
R0627:Cep41 UTSW 6 30656631 missense probably damaging 1.00
R1416:Cep41 UTSW 6 30657357 missense probably damaging 0.97
R1856:Cep41 UTSW 6 30661006 missense probably damaging 0.96
R2265:Cep41 UTSW 6 30660916 missense possibly damaging 0.50
R3881:Cep41 UTSW 6 30658398 missense probably damaging 1.00
R4488:Cep41 UTSW 6 30655689 utr 3 prime probably benign
R4678:Cep41 UTSW 6 30671319 splice site probably null
R4758:Cep41 UTSW 6 30671369 splice site probably benign
R6491:Cep41 UTSW 6 30656484 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGTACCCCAACTCAGAAGTG -3'
(R):5'- GCAGTAAACGGAGCTTCTATTGG -3'

Sequencing Primer
(F):5'- CCTAGACTGTAAACTCTTTGAGGGC -3'
(R):5'- AGCTTCTATTGGCTGGCC -3'
Posted On2019-09-13