Incidental Mutation 'R7344:Prss58'
ID570080
Institutional Source Beutler Lab
Gene Symbol Prss58
Ensembl Gene ENSMUSG00000051936
Gene Nameprotease, serine 58
SynonymsBC048599
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location40895270-40900387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40895465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 208 (I208T)
Ref Sequence ENSEMBL: ENSMUSP00000069833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063523] [ENSMUST00000103262]
Predicted Effect probably damaging
Transcript: ENSMUST00000063523
AA Change: I208T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069833
Gene: ENSMUSG00000051936
AA Change: I208T

DomainStartEndE-ValueType
Tryp_SPc 22 234 4.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103262
SMART Domains Protein: ENSMUSP00000100078
Gene: ENSMUSG00000076461

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:V-set 22 116 8.4e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. This gene and several related trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. This gene was previously described as a trypsinogen-like pseudogene, but it is now thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Prss58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Prss58 APN 6 40895465 missense probably damaging 1.00
IGL01108:Prss58 APN 6 40897344 missense probably damaging 1.00
IGL01645:Prss58 APN 6 40897310 missense probably damaging 0.98
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R1622:Prss58 UTSW 6 40897314 missense possibly damaging 0.84
R2511:Prss58 UTSW 6 40897800 missense probably damaging 1.00
R4292:Prss58 UTSW 6 40897310 missense probably damaging 0.98
R5093:Prss58 UTSW 6 40897817 missense probably damaging 1.00
R5601:Prss58 UTSW 6 40897849 missense possibly damaging 0.92
R5992:Prss58 UTSW 6 40897769 missense probably damaging 1.00
R6806:Prss58 UTSW 6 40897732 missense probably damaging 0.98
R7105:Prss58 UTSW 6 40897766 missense probably damaging 1.00
R7136:Prss58 UTSW 6 40900053 critical splice donor site probably null
R7699:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7700:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7954:Prss58 UTSW 6 40895609 missense possibly damaging 0.92
R8305:Prss58 UTSW 6 40895660 missense probably benign 0.00
R8370:Prss58 UTSW 6 40895424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACTCCACAGACGTGAG -3'
(R):5'- AGAAAACATGATCTGCGTAGGC -3'

Sequencing Primer
(F):5'- TCGCACGGTCTAATGAGC -3'
(R):5'- GTTGCCTGAAAGATGACC -3'
Posted On2019-09-13