Mutagenetix > Incidental Mutation

Incidental Mutation 'R7344:Fancd2'

570082

Institutional Source

Beutler Lab

Gene Symbol

Fancd2

Ensembl Gene

ENSMUSG00000034023

Gene Name

Fanconi anemia, complementation group D2

Synonyms

2410150O07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7344 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113531682-113597017 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 113568709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 901 (V901A)

Ref Sequence

ENSEMBL: ENSMUSP00000045667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000129462] [ENSMUST00000204827]

AlphaFold

Q80V62

PDB Structure

Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000036340
AA Change: V901A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: V901A

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1415	N/A	PFAM
low complexity region	1430	1450	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129462
AA Change: V13A

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000145220
Gene: ENSMUSG00000034023
AA Change: V13A

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	80	4.9e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204827
AA Change: V901A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: V901A

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1402	N/A	PFAM
low complexity region	1417	1437	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	A	C	11: 58,291,447	Y216S		Het
9530053A07Rik	T	C	7: 28,140,279	S506P	possibly damaging	Het
9530053A07Rik	C	T	7: 28,152,760	T1236I	possibly damaging	Het
AI314180	A	T	4: 58,824,770	D1070E	probably benign	Het
Anpep	G	T	7: 79,838,650	S477R	possibly damaging	Het
Atp7b	T	C	8: 21,997,499	D1293G	probably damaging	Het
Caprin2	A	G	6: 148,873,067	V249A	probably benign	Het
Cep41	C	T	6: 30,693,656	R5K	probably benign	Het
Cyp2c23	A	T	19: 44,021,737		probably null	Het
Dazap2	T	A	15: 100,616,943	V15E	possibly damaging	Het
Epha8	T	A	4: 136,934,538	H582L	probably benign	Het
Fam193a	A	G	5: 34,485,730	T1513A	possibly damaging	Het
Fbl	T	A	7: 28,178,935	V284E	probably damaging	Het
Fbln2	A	G	6: 91,269,973	E1065G	probably damaging	Het
Fbxw16	A	G	9: 109,449,035	V25A	probably benign	Het
Gm11562	T	G	11: 99,620,369	T2P	unknown	Het
Gm17728	G	T	17: 9,422,123	G22W	probably damaging	Het
Gm30083	A	G	14: 33,999,580	Y190H	probably benign	Het
Gm6793	T	A	8: 112,014,929	D27V	probably damaging	Het
Gm7324	A	G	14: 43,714,677	D259G	probably benign	Het
Gtf2a1l	G	A	17: 88,694,103	G129D	probably damaging	Het
Ildr2	T	A	1: 166,294,597	V203E	probably damaging	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Irx5	A	G	8: 92,359,555	T89A	probably benign	Het
Itga7	A	G	10: 128,940,929	N221S	possibly damaging	Het
Lpcat2	T	C	8: 92,875,567	W259R	probably damaging	Het
Lrrc8e	C	T	8: 4,234,815	R347C	probably damaging	Het
Lyst	T	A	13: 13,706,555	D2790E	probably benign	Het
Magi2	G	A	5: 20,550,240	R604Q	probably benign	Het
Mertk	C	A	2: 128,771,497	H478N	probably benign	Het
Mical3	T	A	6: 121,036,544	K293*	probably null	Het
Nod2	T	C	8: 88,660,582	L168P	probably damaging	Het
Npnt	T	C	3: 132,908,339		probably null	Het
Olfr1006	A	T	2: 85,674,931	Y73*	probably null	Het
Olfr1375	T	G	11: 51,048,295	F63V	probably damaging	Het
Olfr312	A	T	11: 58,831,482	E109D	probably damaging	Het
Olfr884	T	C	9: 38,047,957	M245T	probably benign	Het
Plcd4	A	T	1: 74,554,652	D312V	probably damaging	Het
Prss58	A	G	6: 40,895,465	I208T	probably damaging	Het
Pus7l	A	G	15: 94,540,617	S116P	probably benign	Het
Rcc1l	A	T	5: 134,176,437	I93N	probably benign	Het
Rftn2	A	C	1: 55,226,152	Y36*	probably null	Het
Rp1l1	G	A	14: 64,029,620	R885Q	probably benign	Het
Rpgrip1	A	T	14: 52,140,659	D488V	probably damaging	Het
Sacs	A	G	14: 61,207,444	Y2313C	possibly damaging	Het
Scrib	T	C	15: 76,049,258	Y1332C	probably damaging	Het
Serpinb10	T	C	1: 107,540,942	V105A	probably damaging	Het
Slc35d1	A	T	4: 103,213,046		probably null	Het
Slfn3	T	C	11: 83,212,822	V173A	probably benign	Het
Smpd3	C	T	8: 106,265,193	V243M	probably damaging	Het
Stard9	A	T	2: 120,704,686	D3808V	possibly damaging	Het
Supt16	A	T	14: 52,173,571	V692D	probably damaging	Het
Tapt1	A	T	5: 44,188,657	V317E	probably damaging	Het
Vmn2r101	T	C	17: 19,611,797	I685T	probably benign	Het
Vmn2r92	A	G	17: 18,167,251	I173V	probably benign	Het
Vps54	T	C	11: 21,274,999	I165T	probably damaging	Het
Zswim4	G	A	8: 84,223,698	R628*	probably null	Het
Zzz3	T	C	3: 152,452,099	S770P	probably damaging	Het

Other mutations in Fancd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fancd2	APN	6	113564396	critical splice donor site	probably null
IGL00475:Fancd2	APN	6	113568610	missense	probably benign	0.01
IGL01319:Fancd2	APN	6	113584899	missense	probably damaging	0.98
IGL01339:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01373:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01393:Fancd2	APN	6	113577360	splice site	probably benign
IGL01630:Fancd2	APN	6	113563124	missense	probably damaging	1.00
IGL01769:Fancd2	APN	6	113545111	missense	possibly damaging	0.90
IGL01882:Fancd2	APN	6	113546640	missense	probably benign	0.05
IGL02029:Fancd2	APN	6	113570975	missense	probably benign	0.44
IGL02224:Fancd2	APN	6	113568320	critical splice donor site	probably null
IGL02271:Fancd2	APN	6	113535759	splice site	probably benign
IGL02352:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02359:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02427:Fancd2	APN	6	113549352	splice site	probably null
IGL02512:Fancd2	APN	6	113570943	missense	probably damaging	1.00
IGL02530:Fancd2	APN	6	113562461	missense	probably damaging	1.00
IGL02801:Fancd2	APN	6	113593317	missense	probably benign	0.00
IGL03090:Fancd2	APN	6	113537597	splice site	probably null
IGL03247:Fancd2	APN	6	113568208	missense	probably benign	0.03
R0278:Fancd2	UTSW	6	113548448	critical splice donor site	probably null
R0401:Fancd2	UTSW	6	113548343	missense	possibly damaging	0.46
R0420:Fancd2	UTSW	6	113536979	missense	probably damaging	0.98
R0496:Fancd2	UTSW	6	113555130	splice site	probably benign
R0762:Fancd2	UTSW	6	113574658	missense	probably benign	0.20
R0827:Fancd2	UTSW	6	113586249	critical splice donor site	probably null
R1225:Fancd2	UTSW	6	113535861	missense	probably damaging	0.99
R1576:Fancd2	UTSW	6	113578405	missense	probably damaging	0.98
R2010:Fancd2	UTSW	6	113593291	missense	probably damaging	0.96
R2079:Fancd2	UTSW	6	113555187	missense	probably damaging	1.00
R2118:Fancd2	UTSW	6	113560074	splice site	probably benign
R2141:Fancd2	UTSW	6	113549321	missense	probably benign	0.00
R2168:Fancd2	UTSW	6	113591159	missense	possibly damaging	0.92
R2180:Fancd2	UTSW	6	113574637	missense	probably benign	0.33
R3016:Fancd2	UTSW	6	113536726	missense	probably benign	0.00
R3153:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3154:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3783:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3786:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3787:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R4379:Fancd2	UTSW	6	113561716	missense	probably benign	0.00
R4388:Fancd2	UTSW	6	113556368	missense	probably damaging	0.99
R4544:Fancd2	UTSW	6	113572642	critical splice acceptor site	probably null
R4598:Fancd2	UTSW	6	113585477	missense	probably benign	0.06
R4832:Fancd2	UTSW	6	113553722	missense	probably benign	0.16
R4841:Fancd2	UTSW	6	113562430	missense	probably damaging	1.00
R4922:Fancd2	UTSW	6	113585473	missense	probably benign	0.03
R5375:Fancd2	UTSW	6	113568712	missense	possibly damaging	0.93
R5579:Fancd2	UTSW	6	113560051	critical splice acceptor site	probably null
R5782:Fancd2	UTSW	6	113548872	missense	probably benign	0.00
R5871:Fancd2	UTSW	6	113556282	missense	probably benign	0.30
R5901:Fancd2	UTSW	6	113549365	missense	probably damaging	1.00
R5909:Fancd2	UTSW	6	113561711	missense	probably benign
R6026:Fancd2	UTSW	6	113551770	missense	possibly damaging	0.46
R6166:Fancd2	UTSW	6	113555251	missense	possibly damaging	0.67
R6393:Fancd2	UTSW	6	113578413	missense	probably benign	0.01
R6666:Fancd2	UTSW	6	113585509	missense	probably damaging	0.96
R6669:Fancd2	UTSW	6	113593327	missense	probably benign	0.00
R6676:Fancd2	UTSW	6	113537665	nonsense	probably null
R6762:Fancd2	UTSW	6	113586016	splice site	probably null
R6911:Fancd2	UTSW	6	113548385	missense	probably damaging	0.98
R6992:Fancd2	UTSW	6	113571018	critical splice donor site	probably null
R7091:Fancd2	UTSW	6	113545101	missense	probably damaging	1.00
R7252:Fancd2	UTSW	6	113556285	missense	probably damaging	0.98
R7343:Fancd2	UTSW	6	113536939	missense	probably benign	0.01
R7354:Fancd2	UTSW	6	113595946	missense	unknown
R7489:Fancd2	UTSW	6	113564304	missense	probably benign
R7501:Fancd2	UTSW	6	113548403	missense	possibly damaging	0.95
R7504:Fancd2	UTSW	6	113545038	missense	probably damaging	1.00
R7992:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R8027:Fancd2	UTSW	6	113546622	missense	probably damaging	1.00
R8487:Fancd2	UTSW	6	113568226	missense	probably damaging	1.00
R8509:Fancd2	UTSW	6	113572570	missense	probably benign	0.00
R8757:Fancd2	UTSW	6	113560093	missense	possibly damaging	0.91
R8960:Fancd2	UTSW	6	113563168	critical splice donor site	probably null
R8978:Fancd2	UTSW	6	113585546	splice site	probably benign
R9110:Fancd2	UTSW	6	113535801	missense	possibly damaging	0.94
R9116:Fancd2	UTSW	6	113555219	missense	probably benign	0.00
R9490:Fancd2	UTSW	6	113578455	missense	probably damaging	0.98
R9667:Fancd2	UTSW	6	113553756	nonsense	probably null
Z1088:Fancd2	UTSW	6	113581422	missense	probably benign	0.00
Z1177:Fancd2	UTSW	6	113545025	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAAAGGTTTCTTTATGGGCAATGC -3'
(R):5'- CAACAACCAAGAGTTTAGAGATCAG -3'

Sequencing Primer
(F):5'- GCTTGAATCATAAAACTTTTCCTCC -3'
(R):5'- GTAAGAACTGTTACTCGAGGGTCATC -3'

Posted On

2019-09-13