Incidental Mutation 'R7344:Caprin2'
ID570084
Institutional Source Beutler Lab
Gene Symbol Caprin2
Ensembl Gene ENSMUSG00000030309
Gene Namecaprin family member 2
SynonymsC1qdc1, Eeg1, RNG140
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location148842492-148896237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148873067 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000107195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072324] [ENSMUST00000111569] [ENSMUST00000139914]
Predicted Effect unknown
Transcript: ENSMUST00000072324
AA Change: V249A
SMART Domains Protein: ENSMUSP00000072165
Gene: ENSMUSG00000030309
AA Change: V249A

DomainStartEndE-ValueType
coiled coil region 48 125 N/A INTRINSIC
coiled coil region 239 264 N/A INTRINSIC
Pfam:Caprin-1_C 317 618 1.2e-32 PFAM
C1Q 676 812 1.27e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111569
AA Change: V249A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107195
Gene: ENSMUSG00000030309
AA Change: V249A

DomainStartEndE-ValueType
coiled coil region 48 125 N/A INTRINSIC
coiled coil region 239 264 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:Caprin-1_C 536 836 2.9e-106 PFAM
C1Q 895 1031 1.27e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139914
SMART Domains Protein: ENSMUSP00000121685
Gene: ENSMUSG00000030309

DomainStartEndE-ValueType
coiled coil region 48 94 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the caprin family. The encoded protein may function as an RNA-binding protein that induces the formation of RNA granules and plays an important role in brain function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Caprin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Caprin2 APN 6 148843071 missense probably damaging 1.00
IGL01364:Caprin2 APN 6 148873028 missense probably benign 0.00
IGL02738:Caprin2 APN 6 148842862 missense probably damaging 1.00
IGL02819:Caprin2 APN 6 148848258 missense probably damaging 0.99
IGL03117:Caprin2 APN 6 148862466 missense possibly damaging 0.91
IGL03123:Caprin2 APN 6 148895007 missense probably damaging 1.00
IGL03378:Caprin2 APN 6 148877854 missense probably benign 0.23
R0242:Caprin2 UTSW 6 148842954 missense probably damaging 1.00
R0242:Caprin2 UTSW 6 148842954 missense probably damaging 1.00
R0621:Caprin2 UTSW 6 148858678 missense possibly damaging 0.94
R0930:Caprin2 UTSW 6 148883511 synonymous probably null
R1540:Caprin2 UTSW 6 148876471 missense probably benign 0.01
R1591:Caprin2 UTSW 6 148873108 missense possibly damaging 0.94
R1763:Caprin2 UTSW 6 148843121 missense probably damaging 1.00
R1885:Caprin2 UTSW 6 148877885 unclassified probably null
R2027:Caprin2 UTSW 6 148877887 missense probably damaging 0.98
R2867:Caprin2 UTSW 6 148846240 synonymous silent
R4856:Caprin2 UTSW 6 148873011 missense probably benign 0.19
R5580:Caprin2 UTSW 6 148858734 missense possibly damaging 0.79
R5696:Caprin2 UTSW 6 148877818 missense possibly damaging 0.49
R5765:Caprin2 UTSW 6 148843168 missense probably damaging 1.00
R5778:Caprin2 UTSW 6 148869322 missense probably benign
R5961:Caprin2 UTSW 6 148863540 missense probably damaging 1.00
R6255:Caprin2 UTSW 6 148877892 missense probably benign 0.28
R6440:Caprin2 UTSW 6 148869645 missense probably damaging 1.00
R6997:Caprin2 UTSW 6 148877976 missense probably damaging 1.00
R7034:Caprin2 UTSW 6 148848205 missense possibly damaging 0.64
R7632:Caprin2 UTSW 6 148883456 missense probably damaging 1.00
R7808:Caprin2 UTSW 6 148843030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTGAAAGCAAAAGGATACCACC -3'
(R):5'- ACCCTGTGGCCAATATTCTTG -3'

Sequencing Primer
(F):5'- TAATCTCAGTACTCAGAAGCAGG -3'
(R):5'- GCAGGATAGCATTGAGTCTTATTCTC -3'
Posted On2019-09-13