Incidental Mutation 'R7344:Lrrc8e'
ID570089
Institutional Source Beutler Lab
Gene Symbol Lrrc8e
Ensembl Gene ENSMUSG00000046589
Gene Nameleucine rich repeat containing 8 family, member E
Synonyms1810049O03Rik, C87354
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4226827-4237470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4234815 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 347 (R347C)
Ref Sequence ENSEMBL: ENSMUSP00000052055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000053035] [ENSMUST00000062686] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000145165] [ENSMUST00000207770]
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053035
AA Change: R347C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052055
Gene: ENSMUSG00000046589
AA Change: R347C

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 330 3.8e-143 PFAM
low complexity region 504 516 N/A INTRINSIC
LRR 603 627 3.97e0 SMART
LRR 628 650 2.33e2 SMART
LRR_TYP 651 674 6.08e-5 SMART
LRR 676 696 6.78e1 SMART
LRR_TYP 697 720 2.43e-4 SMART
LRR 721 742 1.09e2 SMART
LRR_TYP 743 766 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207770
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small, conserved family of proteins with similar structure, including a string of extracellular leucine-rich repeats. A related protein was shown to be involved in B-cell development. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Lrrc8e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lrrc8e APN 8 4235921 missense probably benign
IGL00943:Lrrc8e APN 8 4235658 missense probably damaging 1.00
IGL00979:Lrrc8e APN 8 4235080 missense probably damaging 1.00
IGL01138:Lrrc8e APN 8 4234084 missense probably damaging 1.00
IGL01458:Lrrc8e APN 8 4236141 missense probably damaging 1.00
IGL02524:Lrrc8e APN 8 4235392 missense probably damaging 1.00
IGL02831:Lrrc8e APN 8 4235429 missense probably damaging 0.96
IGL03135:Lrrc8e APN 8 4235776 missense probably damaging 1.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0242:Lrrc8e UTSW 8 4235401 missense probably benign 0.00
R0312:Lrrc8e UTSW 8 4235733 missense probably benign
R0601:Lrrc8e UTSW 8 4235239 unclassified probably null
R1167:Lrrc8e UTSW 8 4235337 missense probably benign
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1405:Lrrc8e UTSW 8 4231754 missense probably damaging 1.00
R1540:Lrrc8e UTSW 8 4234990 missense probably benign 0.41
R1677:Lrrc8e UTSW 8 4234190 missense probably damaging 1.00
R1916:Lrrc8e UTSW 8 4235202 missense probably benign 0.01
R2185:Lrrc8e UTSW 8 4234986 nonsense probably null
R2290:Lrrc8e UTSW 8 4231770 missense probably damaging 1.00
R3424:Lrrc8e UTSW 8 4234611 missense probably damaging 1.00
R4628:Lrrc8e UTSW 8 4233981 missense probably damaging 1.00
R4996:Lrrc8e UTSW 8 4235166 missense probably damaging 1.00
R5169:Lrrc8e UTSW 8 4234329 missense probably benign
R5516:Lrrc8e UTSW 8 4235818 missense probably damaging 1.00
R5870:Lrrc8e UTSW 8 4235725 missense possibly damaging 0.60
R6687:Lrrc8e UTSW 8 4234798 missense probably damaging 1.00
R6700:Lrrc8e UTSW 8 4236034 missense probably damaging 1.00
R7350:Lrrc8e UTSW 8 4235626 missense probably benign 0.14
R7555:Lrrc8e UTSW 8 4234363 missense probably benign 0.05
R7691:Lrrc8e UTSW 8 4234534 missense probably damaging 1.00
Z1176:Lrrc8e UTSW 8 4234822 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTGATCTATGTGGAGAAGATCAG -3'
(R):5'- TCAGCTTCTCAGGTGTCCAC -3'

Sequencing Primer
(F):5'- AGAAGATCAGCTTTCTGGTGGCC -3'
(R):5'- AGCTTCTCAGGTGTCCACTCATG -3'
Posted On2019-09-13