Incidental Mutation 'R7344:Irx5'
ID570093
Institutional Source Beutler Lab
Gene Symbol Irx5
Ensembl Gene ENSMUSG00000031737
Gene NameIroquois homeobox 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location92357625-92376286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92359555 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 89 (T89A)
Ref Sequence ENSEMBL: ENSMUSP00000034184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034184] [ENSMUST00000210246]
Predicted Effect probably benign
Transcript: ENSMUST00000034184
AA Change: T89A

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034184
Gene: ENSMUSG00000031737
AA Change: T89A

DomainStartEndE-ValueType
HOX 112 177 1.14e-12 SMART
low complexity region 185 202 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
IRO 328 345 2.28e-5 SMART
low complexity region 351 369 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 417 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210246
AA Change: T89A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, narrow eye opening, and impaired retinal cone bipolar cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Irx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Irx5 APN 8 92360703 missense probably damaging 1.00
IGL01870:Irx5 APN 8 92359777 missense probably damaging 1.00
IGL01985:Irx5 APN 8 92359527 splice site probably benign
IGL02481:Irx5 APN 8 92360679 missense probably damaging 1.00
IGL02597:Irx5 APN 8 92360772 missense possibly damaging 0.93
IGL03257:Irx5 APN 8 92360630 missense probably benign 0.00
R0784:Irx5 UTSW 8 92360490 missense probably benign
R1498:Irx5 UTSW 8 92359886 missense probably damaging 1.00
R1762:Irx5 UTSW 8 92359644 missense probably damaging 1.00
R1783:Irx5 UTSW 8 92359688 missense probably damaging 1.00
R1951:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R1953:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R2019:Irx5 UTSW 8 92358364 missense probably damaging 1.00
R3875:Irx5 UTSW 8 92360165 missense probably benign 0.00
R3942:Irx5 UTSW 8 92359686 missense probably damaging 0.98
R4361:Irx5 UTSW 8 92358397 missense probably damaging 0.99
R4574:Irx5 UTSW 8 92358262 missense probably damaging 0.99
R4994:Irx5 UTSW 8 92360781 missense probably damaging 1.00
R5579:Irx5 UTSW 8 92359913 missense probably benign 0.01
R5884:Irx5 UTSW 8 92360630 missense possibly damaging 0.95
R5988:Irx5 UTSW 8 92360671 nonsense probably null
R6017:Irx5 UTSW 8 92358250 missense probably damaging 1.00
R6339:Irx5 UTSW 8 92359853 missense probably damaging 0.99
R6466:Irx5 UTSW 8 92359726 missense probably damaging 1.00
R6595:Irx5 UTSW 8 92359619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCTAAACCCTGAACAGC -3'
(R):5'- GGCCAGCATGATCTTCTCTC -3'

Sequencing Primer
(F):5'- AAGGTGGTCACTCTTGCGTTTAAAC -3'
(R):5'- AGCATGATCTTCTCTCCCTTGGTG -3'
Posted On2019-09-13