Incidental Mutation 'R7344:Supt16'
ID570110
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Namesuppressor of Ty 16
SynonymsSupt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52160414-52197416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52173571 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 692 (V692D)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: V692D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: V692D

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATCAAAGTCACTAGCCTACTGTAC -3'
(R):5'- GGACTGTAGCTTCCCAGAGTAG -3'

Sequencing Primer
(F):5'- TCATGTTTTTAAAAACCTCTTTACCG -3'
(R):5'- CTGTAGCTTCCCAGAGTAGAACATG -3'
Posted On2019-09-13