Incidental Mutation 'R7344:Ipo4'
ID570111
Institutional Source Beutler Lab
Gene Symbol Ipo4
Ensembl Gene ENSMUSG00000002319
Gene Nameimportin 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55625400-55635957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55635531 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 23 (R23Q)
Ref Sequence ENSEMBL: ENSMUSP00000036555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000047131] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000125133] [ENSMUST00000132338] [ENSMUST00000135221] [ENSMUST00000148351] [ENSMUST00000149726]
Predicted Effect probably benign
Transcript: ENSMUST00000002391
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047131
AA Change: R23Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319
AA Change: R23Q

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120041
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121791
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121937
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122358
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect probably benign
Transcript: ENSMUST00000132338
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135221
AA Change: R23Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319
AA Change: R23Q

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148351
AA Change: R23Q

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319
AA Change: R23Q

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149726
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Ipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0277:Ipo4 UTSW 14 55632115 missense probably benign 0.03
R0344:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0467:Ipo4 UTSW 14 55635526 start codon destroyed probably null
R1167:Ipo4 UTSW 14 55635020 missense probably damaging 1.00
R1217:Ipo4 UTSW 14 55634359 missense probably damaging 0.98
R1804:Ipo4 UTSW 14 55629456 missense probably damaging 1.00
R2270:Ipo4 UTSW 14 55634100 missense probably damaging 1.00
R3551:Ipo4 UTSW 14 55633103 missense probably benign 0.10
R4561:Ipo4 UTSW 14 55630089 splice site probably benign
R4801:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4802:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4804:Ipo4 UTSW 14 55630856 missense possibly damaging 0.80
R5384:Ipo4 UTSW 14 55626196 missense probably benign 0.28
R5493:Ipo4 UTSW 14 55630870 missense probably benign 0.00
R5527:Ipo4 UTSW 14 55632050 unclassified probably null
R5631:Ipo4 UTSW 14 55632069 missense probably damaging 1.00
R5631:Ipo4 UTSW 14 55633381 missense probably benign 0.08
R5788:Ipo4 UTSW 14 55628820 missense probably benign 0.02
R5929:Ipo4 UTSW 14 55631189 missense probably benign 0.03
R6018:Ipo4 UTSW 14 55626152 critical splice donor site probably null
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6707:Ipo4 UTSW 14 55628904 missense possibly damaging 0.82
R7345:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7702:Ipo4 UTSW 14 55632330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGACACATTGAGGAATTTC -3'
(R):5'- ACGCAGAGTAACGCCCTTTC -3'

Sequencing Primer
(F):5'- TTTCAGAATTTCGGCAAGGAGG -3'
(R):5'- TTTCCGCCGGAAGTTGC -3'
Posted On2019-09-13