Incidental Mutation 'R7344:Pus7l'
ID570115
Institutional Source Beutler Lab
Gene Symbol Pus7l
Ensembl Gene ENSMUSG00000033356
Gene Namepseudouridylate synthase 7-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7344 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location94522688-94543547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94540617 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 116 (S116P)
Ref Sequence ENSEMBL: ENSMUSP00000044075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049151] [ENSMUST00000074936] [ENSMUST00000109248] [ENSMUST00000134061]
Predicted Effect probably benign
Transcript: ENSMUST00000049151
AA Change: S116P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000044075
Gene: ENSMUSG00000033356
AA Change: S116P

DomainStartEndE-ValueType
Pfam:TruD 280 697 1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074936
SMART Domains Protein: ENSMUSP00000074471
Gene: ENSMUSG00000059883

DomainStartEndE-ValueType
PDB:1WH4|A 1 114 1e-78 PDB
Pfam:Pkinase_Tyr 187 454 3.3e-53 PFAM
Pfam:Pkinase 187 456 4.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109248
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134061
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slc35d1 A T 4: 103,213,046 probably null Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Pus7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Pus7l APN 15 94531612 missense probably benign 0.07
IGL02049:Pus7l APN 15 94540178 missense probably damaging 1.00
IGL02484:Pus7l APN 15 94529488 missense possibly damaging 0.70
IGL02731:Pus7l APN 15 94523464 missense probably benign 0.03
IGL03252:Pus7l APN 15 94525810 missense probably benign 0.00
IGL03392:Pus7l APN 15 94536568 missense probably damaging 1.00
R0638:Pus7l UTSW 15 94523417 missense probably benign 0.20
R0848:Pus7l UTSW 15 94540512 missense probably benign 0.16
R1646:Pus7l UTSW 15 94533636 missense probably benign 0.33
R1785:Pus7l UTSW 15 94540637 missense probably benign 0.04
R2046:Pus7l UTSW 15 94540785 missense probably benign 0.01
R2206:Pus7l UTSW 15 94523590 missense probably damaging 1.00
R2210:Pus7l UTSW 15 94540292 missense possibly damaging 0.95
R3618:Pus7l UTSW 15 94527907 missense probably damaging 0.97
R4485:Pus7l UTSW 15 94523490 missense probably benign 0.00
R4487:Pus7l UTSW 15 94531617 missense possibly damaging 0.46
R4686:Pus7l UTSW 15 94540211 missense probably damaging 1.00
R4739:Pus7l UTSW 15 94540710 missense probably benign 0.02
R4975:Pus7l UTSW 15 94529488 missense possibly damaging 0.70
R5431:Pus7l UTSW 15 94529486 missense probably damaging 1.00
R5567:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5570:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5896:Pus7l UTSW 15 94529451 splice site probably null
R6408:Pus7l UTSW 15 94531575 missense probably benign 0.06
R6681:Pus7l UTSW 15 94527865 missense probably benign 0.00
R7811:Pus7l UTSW 15 94540826 missense probably damaging 1.00
X0065:Pus7l UTSW 15 94540773 missense possibly damaging 0.87
X0066:Pus7l UTSW 15 94529493 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CCTGGTTTCCTACGGTGATC -3'
(R):5'- TTAGTCAGTAAGGCCACCGATG -3'

Sequencing Primer
(F):5'- CAGAACAGCTCTGCGGTTTTTG -3'
(R):5'- ACCGATGGATCTCTCTATGAAATTAG -3'
Posted On2019-09-13