Mutagenetix > Incidental Mutations

Incidental Mutation 'R7345:Il1a'

570123

Institutional Source

Beutler Lab

Gene Symbol

Il1a

Ensembl Gene

ENSMUSG00000027399

Gene Name

interleukin 1 alpha

Synonyms

Il-1a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129299610-129309972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 129304773 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 133 (R133S)

Ref Sequence

ENSEMBL: ENSMUSP00000028882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028882]

AlphaFold

P01582

Predicted Effect

probably benign
Transcript: ENSMUST00000028882
AA Change: R133S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028882
Gene: ENSMUSG00000027399
AA Change: R133S

Domain	Start	End	E-Value	Type
Pfam:IL1_propep	1	111	2.2e-38	PFAM
IL1	131	270	8.14e-70	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal tumor vascularization, decreased metastatic potential, and decreased interleukin-1 beta secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks3	A	G	16: 4,955,910	M174T	possibly damaging	Het
Arhgap23	G	A	11: 97,466,478	R934Q	possibly damaging	Het
Atad5	T	C	11: 80,096,006	S640P	probably damaging	Het
B3galnt2	C	T	13: 13,980,480		probably null	Het
B430305J03Rik	T	C	3: 61,364,118	S69G	unknown	Het
C87499	T	C	4: 88,628,179	K309E	possibly damaging	Het
Cd163	A	T	6: 124,318,938	N747I	possibly damaging	Het
Cep126	A	G	9: 8,099,816	S906P	probably damaging	Het
Cyp4f39	G	A	17: 32,486,779	G318R	probably damaging	Het
D630003M21Rik	C	T	2: 158,217,209	G257D	probably damaging	Het
Dcaf10	T	C	4: 45,342,583	L139P	probably damaging	Het
Dcc	A	G	18: 71,378,824	V840A	probably benign	Het
Dnhd1	A	T	7: 105,703,967	I2776L	probably benign	Het
Fam166b	T	C	4: 43,428,022	D145G	possibly damaging	Het
Fbxo24	G	T	5: 137,621,261	F234L	probably damaging	Het
Gm21190	T	C	5: 15,527,904		probably null	Het
Grhl3	C	T	4: 135,546,246	R565Q	probably damaging	Het
Gtf3c1	A	T	7: 125,645,670	Y1731N	probably damaging	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Klc3	G	A	7: 19,394,889	T481M	probably benign	Het
Map2k6	A	T	11: 110,492,908	I127F		Het
Mapk8	A	T	14: 33,408,111	N63K	probably damaging	Het
Med13l	T	C	5: 118,742,760	W1306R	probably damaging	Het
Megf6	C	A	4: 154,267,315	Q1162K	probably benign	Het
Myo5b	A	G	18: 74,708,024	E992G	possibly damaging	Het
Ndst4	C	T	3: 125,714,659	T291M	probably benign	Het
Nek10	T	A	14: 14,955,503	F838L	probably benign	Het
Nrm	A	G	17: 35,864,584	H194R	probably damaging	Het
Nup188	T	C	2: 30,340,601	S1384P	probably benign	Het
Olfml2a	C	A	2: 38,960,127	D618E	probably damaging	Het
Olfr466	A	C	13: 65,152,743	N173T	possibly damaging	Het
Olfr506	C	T	7: 108,613,063	T252I	probably benign	Het
Olfr937	A	G	9: 39,060,579	L29P	probably damaging	Het
Olfr938	G	A	9: 39,078,334	S137F	probably damaging	Het
P2ry1	T	C	3: 61,003,674	F78S	possibly damaging	Het
Pcdhb18	T	C	18: 37,491,923	F769L	probably benign	Het
Poc5	A	G	13: 96,396,796	E144G	probably damaging	Het
Pole	T	A	5: 110,303,903	N870K	possibly damaging	Het
Polr2b	T	C	5: 77,349,119	F1159L	possibly damaging	Het
Rubcnl	A	G	14: 75,042,353	Y392C	probably benign	Het
Sec31a	T	C	5: 100,385,270	T539A	probably damaging	Het
Serpinh1	A	C	7: 99,346,356	S340A	probably damaging	Het
Slc1a5	T	A	7: 16,796,160		probably null	Het
Soat2	A	G	15: 102,162,578	D469G	probably benign	Het
Speg	T	C	1: 75,384,835	L70P	probably damaging	Het
Spred2	T	C	11: 19,924,958		probably null	Het
Stac2	A	C	11: 98,042,613	S168A	probably damaging	Het
Stx1a	T	A	5: 135,037,188	D31E	probably benign	Het
Timeless	C	T	10: 128,249,754	T885M	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tsen34	T	C	7: 3,695,615	Y253H	probably damaging	Het
Unc13b	T	C	4: 43,173,966	V1598A	unknown	Het
Zfat	A	T	15: 68,105,043	Y1086N	probably damaging	Het
Zfp551	G	A	7: 12,416,595	H296Y	probably benign	Het

Other mutations in Il1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01663:Il1a	APN	2	129304717	missense	probably benign
IGL01726:Il1a	APN	2	129304720	missense	possibly damaging	0.47
IGL02451:Il1a	APN	2	129306655	missense	probably damaging	0.98
IGL02537:Il1a	APN	2	129309076	missense	probably damaging	0.98
R0009:Il1a	UTSW	2	129309074	missense	probably damaging	0.99
R0009:Il1a	UTSW	2	129309074	missense	probably damaging	0.99
R0759:Il1a	UTSW	2	129304687	missense	probably damaging	1.00
R1388:Il1a	UTSW	2	129306581	missense	possibly damaging	0.92
R1521:Il1a	UTSW	2	129304741	missense	possibly damaging	0.83
R1699:Il1a	UTSW	2	129302893	missense	probably damaging	0.98
R3833:Il1a	UTSW	2	129306679	missense	possibly damaging	0.81
R4591:Il1a	UTSW	2	129306527	missense	probably damaging	1.00
R4643:Il1a	UTSW	2	129304703	missense	probably benign
R5433:Il1a	UTSW	2	129307901	missense	possibly damaging	0.79
R5572:Il1a	UTSW	2	129307918	missense	possibly damaging	0.83
R7876:Il1a	UTSW	2	129300842	missense	probably damaging	1.00
R8116:Il1a	UTSW	2	129302944	missense	probably damaging	1.00
R8162:Il1a	UTSW	2	129306557	missense	possibly damaging	0.92
R8248:Il1a	UTSW	2	129302961	missense	probably benign
R9048:Il1a	UTSW	2	129306521	missense	probably benign
R9127:Il1a	UTSW	2	129304795	missense	possibly damaging	0.66
R9320:Il1a	UTSW	2	129300734	missense	probably benign	0.16
R9323:Il1a	UTSW	2	129307906	missense	probably benign	0.24
RF003:Il1a	UTSW	2	129302932	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- CCAGGGATGTAGATAACTCTGTGC -3'
(R):5'- AACTCTGGTGTTCCACTTGG -3'

Sequencing Primer
(F):5'- ACTCTGTGCTTTGAAAACAGAAAG -3'
(R):5'- GGTGTTCCACTTGGATTAGCTACC -3'

Posted On

2019-09-13