Incidental Mutation 'R7345:P2ry1'
ID 570125
Institutional Source Beutler Lab
Gene Symbol P2ry1
Ensembl Gene ENSMUSG00000027765
Gene Name purinergic receptor P2Y, G-protein coupled 1
Synonyms P2Y1, P2Y1 receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R7345 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 61002795-61008982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61003674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 78 (F78S)
Ref Sequence ENSEMBL: ENSMUSP00000029331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029331] [ENSMUST00000193201] [ENSMUST00000193943]
AlphaFold P49650
Predicted Effect possibly damaging
Transcript: ENSMUST00000029331
AA Change: F78S

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029331
Gene: ENSMUSG00000027765
AA Change: F78S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:7tm_1 68 324 4.8e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000193201
AA Change: F78S

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142006
Gene: ENSMUSG00000027765
AA Change: F78S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:7tm_1 68 324 7.2e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000193943
AA Change: F78S

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141371
Gene: ENSMUSG00000027765
AA Change: F78S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:7tm_1 68 324 7.2e-47 PFAM
Meta Mutation Damage Score 0.1040 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor functions as a receptor for extracellular ATP and ADP. In platelets binding to ADP leads to mobilization of intracellular calcium ions via activation of phospholipase C, a change in platelet shape, and probably to platelet aggregation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either one of two independently generated knock-out alleles exhibit decreased platelet aggregation, increased bleeding time, and resistance to induced thromboembolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in P2ry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02324:P2ry1 APN 3 61003778 missense possibly damaging 0.83
IGL03008:P2ry1 APN 3 61003526 missense probably benign 0.01
IGL03083:P2ry1 APN 3 61004315 missense probably benign 0.21
IGL03238:P2ry1 APN 3 61004495 missense probably damaging 0.97
R0255:P2ry1 UTSW 3 61003530 missense probably benign
R2078:P2ry1 UTSW 3 61003697 missense probably damaging 0.97
R2325:P2ry1 UTSW 3 61003578 missense probably damaging 1.00
R2508:P2ry1 UTSW 3 61003479 missense probably damaging 1.00
R3418:P2ry1 UTSW 3 61003712 missense probably damaging 0.99
R3419:P2ry1 UTSW 3 61003712 missense probably damaging 0.99
R3848:P2ry1 UTSW 3 61003459 nonsense probably null
R4716:P2ry1 UTSW 3 61003472 missense probably damaging 1.00
R4728:P2ry1 UTSW 3 61004220 missense probably damaging 1.00
R4756:P2ry1 UTSW 3 61004477 missense probably benign 0.00
R4797:P2ry1 UTSW 3 61003460 missense probably benign 0.01
R5550:P2ry1 UTSW 3 61003811 missense probably damaging 1.00
R6108:P2ry1 UTSW 3 61004175 missense probably damaging 0.99
R6278:P2ry1 UTSW 3 61003794 missense possibly damaging 0.85
R6816:P2ry1 UTSW 3 61003832 missense probably benign 0.40
R7473:P2ry1 UTSW 3 61004088 missense probably damaging 0.97
R8029:P2ry1 UTSW 3 61003522 missense possibly damaging 0.86
R9353:P2ry1 UTSW 3 61004495 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGCTTTGGGGAAACAGTAC -3'
(R):5'- CCAGAGACTTGAGAGGGTACAC -3'

Sequencing Primer
(F):5'- AGTACTGTCGCCTCAACTGCAG -3'
(R):5'- AGATGCTACCGTAGAGATTTACGTG -3'
Posted On 2019-09-13