Mutagenetix > Incidental Mutation

Incidental Mutation 'R7345:Unc13b'

570128

Institutional Source

Beutler Lab

Gene Symbol

Unc13b

Ensembl Gene

ENSMUSG00000028456

Gene Name

unc-13 homolog B (C. elegans)

Synonyms

Unc13h2, Munc13-2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.254) question?

Stock #

R7345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43058953-43264871 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43173966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1598 (V1598A)

Ref Sequence

ENSEMBL: ENSMUSP00000147100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]

AlphaFold

Q9Z1N9

Predicted Effect

probably benign
Transcript: ENSMUST00000079978

SMART Domains

Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1262	1404	4.8e-60	PFAM
C2	1438	1544	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107952

SMART Domains

Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1033	2.02e-53	SMART
Pfam:Membr_traf_MHD	1274	1416	4.8e-60	PFAM
C2	1450	1556	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107953

SMART Domains

Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1263	1403	2.3e-56	PFAM
C2	1457	1563	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163653

SMART Domains

Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1032	4.64e-53	SMART
Pfam:Membr_traf_MHD	1273	1415	4.8e-60	PFAM
C2	1449	1555	7.56e-16	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000207569
AA Change: V1598A

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks3	A	G	16: 4,955,910	M174T	possibly damaging	Het
Arhgap23	G	A	11: 97,466,478	R934Q	possibly damaging	Het
Atad5	T	C	11: 80,096,006	S640P	probably damaging	Het
B3galnt2	C	T	13: 13,980,480		probably null	Het
B430305J03Rik	T	C	3: 61,364,118	S69G	unknown	Het
C87499	T	C	4: 88,628,179	K309E	possibly damaging	Het
Cd163	A	T	6: 124,318,938	N747I	possibly damaging	Het
Cep126	A	G	9: 8,099,816	S906P	probably damaging	Het
Cyp4f39	G	A	17: 32,486,779	G318R	probably damaging	Het
D630003M21Rik	C	T	2: 158,217,209	G257D	probably damaging	Het
Dcaf10	T	C	4: 45,342,583	L139P	probably damaging	Het
Dcc	A	G	18: 71,378,824	V840A	probably benign	Het
Dnhd1	A	T	7: 105,703,967	I2776L	probably benign	Het
Fam166b	T	C	4: 43,428,022	D145G	possibly damaging	Het
Fbxo24	G	T	5: 137,621,261	F234L	probably damaging	Het
Gm21190	T	C	5: 15,527,904		probably null	Het
Grhl3	C	T	4: 135,546,246	R565Q	probably damaging	Het
Gtf3c1	A	T	7: 125,645,670	Y1731N	probably damaging	Het
Il1a	C	A	2: 129,304,773	R133S	probably benign	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Klc3	G	A	7: 19,394,889	T481M	probably benign	Het
Map2k6	A	T	11: 110,492,908	I127F		Het
Mapk8	A	T	14: 33,408,111	N63K	probably damaging	Het
Med13l	T	C	5: 118,742,760	W1306R	probably damaging	Het
Megf6	C	A	4: 154,267,315	Q1162K	probably benign	Het
Myo5b	A	G	18: 74,708,024	E992G	possibly damaging	Het
Ndst4	C	T	3: 125,714,659	T291M	probably benign	Het
Nek10	T	A	14: 14,955,503	F838L	probably benign	Het
Nrm	A	G	17: 35,864,584	H194R	probably damaging	Het
Nup188	T	C	2: 30,340,601	S1384P	probably benign	Het
Olfml2a	C	A	2: 38,960,127	D618E	probably damaging	Het
Olfr466	A	C	13: 65,152,743	N173T	possibly damaging	Het
Olfr506	C	T	7: 108,613,063	T252I	probably benign	Het
Olfr937	A	G	9: 39,060,579	L29P	probably damaging	Het
Olfr938	G	A	9: 39,078,334	S137F	probably damaging	Het
P2ry1	T	C	3: 61,003,674	F78S	possibly damaging	Het
Pcdhb18	T	C	18: 37,491,923	F769L	probably benign	Het
Poc5	A	G	13: 96,396,796	E144G	probably damaging	Het
Pole	T	A	5: 110,303,903	N870K	possibly damaging	Het
Polr2b	T	C	5: 77,349,119	F1159L	possibly damaging	Het
Rubcnl	A	G	14: 75,042,353	Y392C	probably benign	Het
Sec31a	T	C	5: 100,385,270	T539A	probably damaging	Het
Serpinh1	A	C	7: 99,346,356	S340A	probably damaging	Het
Slc1a5	T	A	7: 16,796,160		probably null	Het
Soat2	A	G	15: 102,162,578	D469G	probably benign	Het
Speg	T	C	1: 75,384,835	L70P	probably damaging	Het
Spred2	T	C	11: 19,924,958		probably null	Het
Stac2	A	C	11: 98,042,613	S168A	probably damaging	Het
Stx1a	T	A	5: 135,037,188	D31E	probably benign	Het
Timeless	C	T	10: 128,249,754	T885M	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tsen34	T	C	7: 3,695,615	Y253H	probably damaging	Het
Zfat	A	T	15: 68,105,043	Y1086N	probably damaging	Het
Zfp551	G	A	7: 12,416,595	H296Y	probably benign	Het

Other mutations in Unc13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Unc13b	APN	4	43240285	missense	probably damaging	1.00
IGL00832:Unc13b	APN	4	43258921	missense	probably damaging	1.00
IGL01111:Unc13b	APN	4	43096927	missense	possibly damaging	0.76
IGL01115:Unc13b	APN	4	43258492	missense	probably damaging	1.00
IGL01137:Unc13b	APN	4	43091291	missense	probably damaging	1.00
IGL01637:Unc13b	APN	4	43241066	missense	probably damaging	1.00
IGL01789:Unc13b	APN	4	43239462	missense	probably damaging	1.00
IGL01792:Unc13b	APN	4	43250218	missense	probably damaging	0.99
IGL01877:Unc13b	APN	4	43249583	critical splice donor site	probably null
IGL01924:Unc13b	APN	4	43239385	nonsense	probably null
IGL02087:Unc13b	APN	4	43091270	missense	probably null	1.00
IGL02197:Unc13b	APN	4	43165828	missense	probably damaging	0.99
IGL02504:Unc13b	APN	4	43263031	missense	probably damaging	1.00
IGL02659:Unc13b	APN	4	43235332	missense	probably damaging	1.00
IGL03031:Unc13b	APN	4	43235368	missense	probably damaging	1.00
IGL03036:Unc13b	APN	4	43235249	missense	probably damaging	1.00
IGL03209:Unc13b	APN	4	43239351	missense	probably damaging	0.99
IGL03352:Unc13b	APN	4	43237110	missense	possibly damaging	0.90
BB006:Unc13b	UTSW	4	43174399	missense	unknown
BB016:Unc13b	UTSW	4	43174399	missense	unknown
G1Funyon:Unc13b	UTSW	4	43263568	missense	probably benign
P0028:Unc13b	UTSW	4	43256225	missense	probably damaging	1.00
PIT4585001:Unc13b	UTSW	4	43091298	missense	probably benign	0.03
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0335:Unc13b	UTSW	4	43236983	missense	possibly damaging	0.95
R0504:Unc13b	UTSW	4	43263559	missense	probably damaging	0.99
R0631:Unc13b	UTSW	4	43182849	missense	possibly damaging	0.47
R0748:Unc13b	UTSW	4	43241164	splice site	probably benign
R1275:Unc13b	UTSW	4	43235366	missense	probably damaging	1.00
R1293:Unc13b	UTSW	4	43235190	missense	probably damaging	1.00
R1434:Unc13b	UTSW	4	43239385	nonsense	probably null
R1552:Unc13b	UTSW	4	43237144	missense	probably damaging	0.99
R1591:Unc13b	UTSW	4	43244747	missense	probably damaging	1.00
R1628:Unc13b	UTSW	4	43263371	missense	probably damaging	1.00
R1740:Unc13b	UTSW	4	43240285	missense	probably damaging	1.00
R1839:Unc13b	UTSW	4	43258308	splice site	probably benign
R2045:Unc13b	UTSW	4	43091266	missense	probably damaging	1.00
R2191:Unc13b	UTSW	4	43245566	nonsense	probably null
R2259:Unc13b	UTSW	4	43182780	missense	possibly damaging	0.87
R2307:Unc13b	UTSW	4	43239854	missense	probably damaging	0.98
R2317:Unc13b	UTSW	4	43245514	missense	probably damaging	1.00
R2402:Unc13b	UTSW	4	43095843	missense	probably benign
R2847:Unc13b	UTSW	4	43180404	missense	probably benign	0.04
R3414:Unc13b	UTSW	4	43234658	splice site	probably benign
R3436:Unc13b	UTSW	4	43097028	splice site	probably benign
R3955:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R3957:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R4015:Unc13b	UTSW	4	43237801	missense	probably damaging	1.00
R4650:Unc13b	UTSW	4	43261035	missense	probably damaging	0.97
R4836:Unc13b	UTSW	4	43237137	missense	probably damaging	1.00
R5041:Unc13b	UTSW	4	43237836	missense	probably benign	0.41
R5413:Unc13b	UTSW	4	43257936	critical splice donor site	probably null
R5994:Unc13b	UTSW	4	43172596	intron	probably benign
R6015:Unc13b	UTSW	4	43177995	nonsense	probably null
R6090:Unc13b	UTSW	4	43239306	missense	probably damaging	1.00
R6242:Unc13b	UTSW	4	43165800	missense	possibly damaging	0.92
R6246:Unc13b	UTSW	4	43216246	missense	probably benign	0.18
R6427:Unc13b	UTSW	4	43176966	unclassified	probably benign
R6660:Unc13b	UTSW	4	43177412	unclassified	probably benign
R6670:Unc13b	UTSW	4	43255562	missense	probably damaging	0.99
R6753:Unc13b	UTSW	4	43239331	missense	probably damaging	1.00
R6858:Unc13b	UTSW	4	43165828	missense	possibly damaging	0.85
R6886:Unc13b	UTSW	4	43170156	intron	probably benign
R6969:Unc13b	UTSW	4	43263538	missense	possibly damaging	0.94
R6994:Unc13b	UTSW	4	43171403	intron	probably benign
R6994:Unc13b	UTSW	4	43173203	intron	probably benign
R7080:Unc13b	UTSW	4	43171926	missense	unknown
R7117:Unc13b	UTSW	4	43216544	missense	probably benign	0.33
R7132:Unc13b	UTSW	4	43215757	missense	probably benign	0.17
R7181:Unc13b	UTSW	4	43258893	missense	probably damaging	0.99
R7192:Unc13b	UTSW	4	43258519	missense	probably damaging	1.00
R7246:Unc13b	UTSW	4	43172910	missense	unknown
R7342:Unc13b	UTSW	4	43258703	missense	probably damaging	0.99
R7355:Unc13b	UTSW	4	43237754	missense	probably damaging	1.00
R7391:Unc13b	UTSW	4	43216459	missense	probably benign	0.03
R7419:Unc13b	UTSW	4	43174023	missense	unknown
R7424:Unc13b	UTSW	4	43172235	missense	unknown
R7517:Unc13b	UTSW	4	43215765	missense	probably benign
R7532:Unc13b	UTSW	4	43249565	missense	probably benign	0.44
R7564:Unc13b	UTSW	4	43091258	missense	probably damaging	1.00
R7598:Unc13b	UTSW	4	43263569	missense	probably benign	0.20
R7604:Unc13b	UTSW	4	43170102	missense	unknown
R7604:Unc13b	UTSW	4	43256776	missense	possibly damaging	0.95
R7643:Unc13b	UTSW	4	43216333	missense	probably benign
R7718:Unc13b	UTSW	4	43173854	missense	unknown
R7735:Unc13b	UTSW	4	43165791	missense	probably damaging	1.00
R7756:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177330	small insertion	probably benign
R7757:Unc13b	UTSW	4	43177341	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177312	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177344	small insertion	probably benign
R7781:Unc13b	UTSW	4	43259546	missense	possibly damaging	0.87
R7793:Unc13b	UTSW	4	43172737	missense	unknown
R7858:Unc13b	UTSW	4	43176285	missense	unknown
R7867:Unc13b	UTSW	4	43232573	nonsense	probably null
R7897:Unc13b	UTSW	4	43171860	missense	unknown
R7904:Unc13b	UTSW	4	43217075	missense	probably benign
R7929:Unc13b	UTSW	4	43174399	missense	unknown
R7984:Unc13b	UTSW	4	43173973	missense	unknown
R8069:Unc13b	UTSW	4	43177597	missense	unknown
R8101:Unc13b	UTSW	4	43239918	missense	probably benign	0.08
R8246:Unc13b	UTSW	4	43175954	missense	unknown
R8289:Unc13b	UTSW	4	43172524	nonsense	probably null
R8301:Unc13b	UTSW	4	43263568	missense	probably benign
R8397:Unc13b	UTSW	4	43217290	missense	probably benign	0.12
R8421:Unc13b	UTSW	4	43178304	missense	unknown
R8738:Unc13b	UTSW	4	43177564	missense	unknown
R8746:Unc13b	UTSW	4	43176120	missense	unknown
R8766:Unc13b	UTSW	4	43174722	missense	unknown
R8825:Unc13b	UTSW	4	43237683	splice site	probably benign
R8834:Unc13b	UTSW	4	43175954	missense	unknown
R8862:Unc13b	UTSW	4	43235207	missense	probably damaging	1.00
R8864:Unc13b	UTSW	4	43174724	missense	unknown
R8889:Unc13b	UTSW	4	43176484	missense	unknown
R8892:Unc13b	UTSW	4	43176484	missense	unknown
R8904:Unc13b	UTSW	4	43178531	intron	probably benign
R9089:Unc13b	UTSW	4	43095847	missense	probably damaging	1.00
R9144:Unc13b	UTSW	4	43173649	missense	unknown
R9149:Unc13b	UTSW	4	43176186	missense	unknown
R9173:Unc13b	UTSW	4	43177421	missense	unknown
R9200:Unc13b	UTSW	4	43257352	missense	possibly damaging	0.50
R9232:Unc13b	UTSW	4	43240321	missense	probably benign	0.03
R9269:Unc13b	UTSW	4	43171955	missense	unknown
R9320:Unc13b	UTSW	4	43171044	missense	unknown
R9335:Unc13b	UTSW	4	43216123	missense	possibly damaging	0.86
R9335:Unc13b	UTSW	4	43255551	missense	probably damaging	0.99
R9352:Unc13b	UTSW	4	43177312	small insertion	probably benign
R9352:Unc13b	UTSW	4	43177313	nonsense	probably null
R9378:Unc13b	UTSW	4	43173282	missense	unknown
R9382:Unc13b	UTSW	4	43172512	missense	unknown
R9569:Unc13b	UTSW	4	43177312	small deletion	probably benign
R9622:Unc13b	UTSW	4	43172513	missense
R9687:Unc13b	UTSW	4	43174920	missense	unknown
R9704:Unc13b	UTSW	4	43237102	missense	probably benign	0.31
R9721:Unc13b	UTSW	4	43101869	missense	probably benign
R9753:Unc13b	UTSW	4	43182842	nonsense	probably null
RF016:Unc13b	UTSW	4	43177347	small insertion	probably benign
RF016:Unc13b	UTSW	4	43177350	small insertion	probably benign
RF041:Unc13b	UTSW	4	43177338	small insertion	probably benign
RF056:Unc13b	UTSW	4	43177359	small insertion	probably benign
Z1176:Unc13b	UTSW	4	43171419	missense	unknown
Z1176:Unc13b	UTSW	4	43177191	missense	unknown
Z1176:Unc13b	UTSW	4	43177764	missense	unknown
Z1176:Unc13b	UTSW	4	43261043	missense	probably benign	0.11
Z1177:Unc13b	UTSW	4	43173669	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTGCTCTTTGCTACAACAACAATC -3'
(R):5'- TCTCATTTCTCGGCAAAGTTACAG -3'

Sequencing Primer
(F):5'- GCTACAACAACAATCATTAGGAATGG -3'
(R):5'- CTCGGCAAAGTTACAGATAAGTC -3'

Posted On

2019-09-13