Incidental Mutation 'R7345:Dcaf10'
ID570130
Institutional Source Beutler Lab
Gene Symbol Dcaf10
Ensembl Gene ENSMUSG00000035572
Gene NameDDB1 and CUL4 associated factor 10
SynonymsWdr32
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45342101-45379759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45342583 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 139 (L139P)
Ref Sequence ENSEMBL: ENSMUSP00000117082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000155551]
Predicted Effect probably benign
Transcript: ENSMUST00000152056
SMART Domains Protein: ENSMUSP00000115532
Gene: ENSMUSG00000028322

DomainStartEndE-ValueType
Blast:S1 24 93 8e-38 BLAST
Pfam:KH_6 109 145 8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155551
AA Change: L139P

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117082
Gene: ENSMUSG00000035572
AA Change: L139P

DomainStartEndE-ValueType
low complexity region 15 46 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
WD40 166 203 1.71e1 SMART
WD40 206 245 7.85e-7 SMART
WD40 249 288 2.59e-7 SMART
WD40 295 334 2.05e1 SMART
low complexity region 352 374 N/A INTRINSIC
Blast:WD40 468 506 3e-10 BLAST
WD40 524 563 1.31e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Dcaf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02431:Dcaf10 APN 4 45342630 missense probably benign 0.01
IGL02660:Dcaf10 APN 4 45372769 missense possibly damaging 0.92
R0048:Dcaf10 UTSW 4 45374262 nonsense probably null
R0550:Dcaf10 UTSW 4 45372753 missense probably benign
R0611:Dcaf10 UTSW 4 45373011 missense probably damaging 1.00
R2289:Dcaf10 UTSW 4 45359816 missense probably damaging 1.00
R2973:Dcaf10 UTSW 4 45373957 missense probably benign 0.04
R3610:Dcaf10 UTSW 4 45372962 nonsense probably null
R3735:Dcaf10 UTSW 4 45348117 missense probably benign 0.01
R4655:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4665:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4690:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4724:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4725:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4735:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4743:Dcaf10 UTSW 4 45370409 missense probably damaging 0.98
R5220:Dcaf10 UTSW 4 45373909 missense possibly damaging 0.94
R5254:Dcaf10 UTSW 4 45370415 missense possibly damaging 0.94
R5855:Dcaf10 UTSW 4 45342558 missense probably benign 0.18
R6833:Dcaf10 UTSW 4 45373043 missense probably damaging 1.00
R7132:Dcaf10 UTSW 4 45342391 missense probably benign
R7366:Dcaf10 UTSW 4 45373919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATGTTTCCCTTCGGGC -3'
(R):5'- CTCATAGGTGACAAAGTACCGG -3'

Sequencing Primer
(F):5'- CGGAGCTCTGGAGTTGTCC -3'
(R):5'- CAGCCTGAGCGGAGGGAG -3'
Posted On2019-09-13