Mutagenetix > Incidental Mutation

Incidental Mutation 'R7345:Grhl3'

570132

Institutional Source

Beutler Lab

Gene Symbol

Grhl3

Ensembl Gene

ENSMUSG00000037188

Gene Name

grainyhead like transcription factor 3

Synonyms

Som, ct, Get1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R7345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135541888-135573630 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 135546246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 565 (R565Q)

Ref Sequence

ENSEMBL: ENSMUSP00000101481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105855]

AlphaFold

Q5FWH3

Predicted Effect

probably damaging
Transcript: ENSMUST00000105855
AA Change: R565Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000101481
Gene: ENSMUSG00000037188
AA Change: R565Q

Domain	Start	End	E-Value	Type
Pfam:CP2	215	421	2.5e-81	PFAM

Meta Mutation Damage Score

0.2774

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for the variably penetrant curly-tail mutation (ct) show symptoms of cranial or spinal neural tube defects such as curly tails and/or spina bifida; homozygotes with more severe phenotypes display exencephaly and die in utero. Homozygous knockout mice show severe neural tube defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks3	A	G	16: 4,955,910	M174T	possibly damaging	Het
Arhgap23	G	A	11: 97,466,478	R934Q	possibly damaging	Het
Atad5	T	C	11: 80,096,006	S640P	probably damaging	Het
B3galnt2	C	T	13: 13,980,480		probably null	Het
B430305J03Rik	T	C	3: 61,364,118	S69G	unknown	Het
C87499	T	C	4: 88,628,179	K309E	possibly damaging	Het
Cd163	A	T	6: 124,318,938	N747I	possibly damaging	Het
Cep126	A	G	9: 8,099,816	S906P	probably damaging	Het
Cyp4f39	G	A	17: 32,486,779	G318R	probably damaging	Het
D630003M21Rik	C	T	2: 158,217,209	G257D	probably damaging	Het
Dcaf10	T	C	4: 45,342,583	L139P	probably damaging	Het
Dcc	A	G	18: 71,378,824	V840A	probably benign	Het
Dnhd1	A	T	7: 105,703,967	I2776L	probably benign	Het
Fam166b	T	C	4: 43,428,022	D145G	possibly damaging	Het
Fbxo24	G	T	5: 137,621,261	F234L	probably damaging	Het
Gm21190	T	C	5: 15,527,904		probably null	Het
Gtf3c1	A	T	7: 125,645,670	Y1731N	probably damaging	Het
Il1a	C	A	2: 129,304,773	R133S	probably benign	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Klc3	G	A	7: 19,394,889	T481M	probably benign	Het
Map2k6	A	T	11: 110,492,908	I127F		Het
Mapk8	A	T	14: 33,408,111	N63K	probably damaging	Het
Med13l	T	C	5: 118,742,760	W1306R	probably damaging	Het
Megf6	C	A	4: 154,267,315	Q1162K	probably benign	Het
Myo5b	A	G	18: 74,708,024	E992G	possibly damaging	Het
Ndst4	C	T	3: 125,714,659	T291M	probably benign	Het
Nek10	T	A	14: 14,955,503	F838L	probably benign	Het
Nrm	A	G	17: 35,864,584	H194R	probably damaging	Het
Nup188	T	C	2: 30,340,601	S1384P	probably benign	Het
Olfml2a	C	A	2: 38,960,127	D618E	probably damaging	Het
Olfr466	A	C	13: 65,152,743	N173T	possibly damaging	Het
Olfr506	C	T	7: 108,613,063	T252I	probably benign	Het
Olfr937	A	G	9: 39,060,579	L29P	probably damaging	Het
Olfr938	G	A	9: 39,078,334	S137F	probably damaging	Het
P2ry1	T	C	3: 61,003,674	F78S	possibly damaging	Het
Pcdhb18	T	C	18: 37,491,923	F769L	probably benign	Het
Poc5	A	G	13: 96,396,796	E144G	probably damaging	Het
Pole	T	A	5: 110,303,903	N870K	possibly damaging	Het
Polr2b	T	C	5: 77,349,119	F1159L	possibly damaging	Het
Rubcnl	A	G	14: 75,042,353	Y392C	probably benign	Het
Sec31a	T	C	5: 100,385,270	T539A	probably damaging	Het
Serpinh1	A	C	7: 99,346,356	S340A	probably damaging	Het
Slc1a5	T	A	7: 16,796,160		probably null	Het
Soat2	A	G	15: 102,162,578	D469G	probably benign	Het
Speg	T	C	1: 75,384,835	L70P	probably damaging	Het
Spred2	T	C	11: 19,924,958		probably null	Het
Stac2	A	C	11: 98,042,613	S168A	probably damaging	Het
Stx1a	T	A	5: 135,037,188	D31E	probably benign	Het
Timeless	C	T	10: 128,249,754	T885M	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tsen34	T	C	7: 3,695,615	Y253H	probably damaging	Het
Unc13b	T	C	4: 43,173,966	V1598A	unknown	Het
Zfat	A	T	15: 68,105,043	Y1086N	probably damaging	Het
Zfp551	G	A	7: 12,416,595	H296Y	probably benign	Het

Other mutations in Grhl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02638:Grhl3	APN	4	135556865	missense	probably benign	0.00
IGL02868:Grhl3	APN	4	135554604	missense	probably damaging	1.00
Bite-size	UTSW	4	135557433	missense	possibly damaging	0.46
hammerkop	UTSW	4	135546246	missense	probably damaging	1.00
hoopoe	UTSW	4	135559146	missense	probably benign	0.00
Tropicbird	UTSW	4	135559104	nonsense	probably null
R0121:Grhl3	UTSW	4	135552549	missense	probably damaging	0.97
R0180:Grhl3	UTSW	4	135554530	missense	probably benign	0.00
R0627:Grhl3	UTSW	4	135552681	missense	probably benign	0.18
R0727:Grhl3	UTSW	4	135546254	missense	possibly damaging	0.90
R1248:Grhl3	UTSW	4	135561306	missense	probably benign	0.01
R1664:Grhl3	UTSW	4	135552550	missense	probably benign	0.11
R2910:Grhl3	UTSW	4	135559146	missense	probably benign	0.00
R2911:Grhl3	UTSW	4	135559146	missense	probably benign	0.00
R3773:Grhl3	UTSW	4	135555847	nonsense	probably null
R4033:Grhl3	UTSW	4	135573424	start codon destroyed	probably benign
R4521:Grhl3	UTSW	4	135546250	missense	probably damaging	1.00
R4576:Grhl3	UTSW	4	135561251	missense	probably damaging	1.00
R4650:Grhl3	UTSW	4	135549236	splice site	probably null
R4697:Grhl3	UTSW	4	135548466	missense	probably damaging	1.00
R4919:Grhl3	UTSW	4	135559104	nonsense	probably null
R4920:Grhl3	UTSW	4	135559104	nonsense	probably null
R4961:Grhl3	UTSW	4	135552607	missense	probably damaging	1.00
R5100:Grhl3	UTSW	4	135542675	missense	probably benign
R5180:Grhl3	UTSW	4	135559104	nonsense	probably null
R5181:Grhl3	UTSW	4	135559104	nonsense	probably null
R5325:Grhl3	UTSW	4	135559104	nonsense	probably null
R6429:Grhl3	UTSW	4	135557196	missense	probably damaging	0.99
R6459:Grhl3	UTSW	4	135557433	missense	possibly damaging	0.46
R7047:Grhl3	UTSW	4	135549240	splice site	probably null
R7073:Grhl3	UTSW	4	135573412	missense	probably benign	0.00
R7797:Grhl3	UTSW	4	135559105	missense	possibly damaging	0.93
R7829:Grhl3	UTSW	4	135561221	missense	probably damaging	0.98
R8023:Grhl3	UTSW	4	135550329	missense	probably benign
R8472:Grhl3	UTSW	4	135556865	missense	probably benign	0.00
R8499:Grhl3	UTSW	4	135549238	critical splice donor site	probably null
R8766:Grhl3	UTSW	4	135573413	missense	probably benign	0.00
R8836:Grhl3	UTSW	4	135561329	missense	probably damaging	1.00
R9466:Grhl3	UTSW	4	135556101	missense	probably benign	0.06
Z1177:Grhl3	UTSW	4	135552686	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGTGAGAAGACCCTTGCACC -3'
(R):5'- TGTTCTCCCCAGGGAAATAGG -3'

Sequencing Primer
(F):5'- GAGAAGACCCTTGCACCTCCTC -3'
(R):5'- TCTCCCCAGGGAAATAGGATCATTG -3'

Posted On

2019-09-13