Incidental Mutation 'R7345:Med13l'
ID570137
Institutional Source Beutler Lab
Gene Symbol Med13l
Ensembl Gene ENSMUSG00000018076
Gene Namemediator complex subunit 13-like
Synonyms9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location118560679-118765438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118742760 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1306 (W1306R)
Ref Sequence ENSEMBL: ENSMUSP00000098379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000100816
AA Change: W1306R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: W1306R

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 2.5e-116 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2197 1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201010
AA Change: W1306R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: W1306R

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 1e-112 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2206 1.7e-138 PFAM
Meta Mutation Damage Score 0.9546 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Med13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Med13l APN 5 118724071 missense probably damaging 0.99
IGL01012:Med13l APN 5 118734028 missense probably damaging 0.99
IGL01316:Med13l APN 5 118762781 missense probably damaging 1.00
IGL01529:Med13l APN 5 118742335 missense probably damaging 1.00
IGL01731:Med13l APN 5 118742407 missense probably benign 0.05
IGL01790:Med13l APN 5 118593522 missense probably damaging 1.00
IGL02394:Med13l APN 5 118748833 missense probably benign 0.37
IGL02432:Med13l APN 5 118738400 missense possibly damaging 0.90
IGL02698:Med13l APN 5 118762829 missense probably damaging 0.99
IGL02801:Med13l APN 5 118745113 missense probably damaging 1.00
IGL03242:Med13l APN 5 118747445 missense probably benign
IGL03270:Med13l APN 5 118731430 missense probably damaging 1.00
Basics UTSW 5 118759264 critical splice donor site probably null
Fundament UTSW 5 118721474 missense probably damaging 1.00
Root UTSW 5 118593445 missense probably damaging 1.00
P0035:Med13l UTSW 5 118742620 missense probably benign 0.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0136:Med13l UTSW 5 118724050 missense probably benign 0.15
R0158:Med13l UTSW 5 118742449 missense unknown
R0197:Med13l UTSW 5 118671002 splice site probably benign
R0370:Med13l UTSW 5 118741826 missense probably benign 0.14
R0492:Med13l UTSW 5 118738495 missense probably damaging 1.00
R0532:Med13l UTSW 5 118759123 missense possibly damaging 0.78
R0726:Med13l UTSW 5 118748684 missense probably damaging 0.99
R0738:Med13l UTSW 5 118751633 missense probably damaging 0.99
R0827:Med13l UTSW 5 118726247 splice site probably benign
R0883:Med13l UTSW 5 118671002 splice site probably benign
R0959:Med13l UTSW 5 118754285 missense possibly damaging 0.89
R1458:Med13l UTSW 5 118738459 missense probably benign 0.00
R1562:Med13l UTSW 5 118738519 missense probably damaging 1.00
R1577:Med13l UTSW 5 118721392 missense probably damaging 1.00
R1661:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1665:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1720:Med13l UTSW 5 118741995 missense probably damaging 1.00
R1929:Med13l UTSW 5 118728833 missense probably benign 0.01
R1967:Med13l UTSW 5 118761322 missense probably damaging 0.99
R2301:Med13l UTSW 5 118593447 missense probably damaging 1.00
R3691:Med13l UTSW 5 118721497 missense probably benign 0.16
R3895:Med13l UTSW 5 118761323 missense probably null 0.99
R4043:Med13l UTSW 5 118593463 missense probably damaging 1.00
R4593:Med13l UTSW 5 118742560 missense probably damaging 1.00
R4902:Med13l UTSW 5 118745130 missense probably damaging 1.00
R4995:Med13l UTSW 5 118730949 missense possibly damaging 0.90
R5010:Med13l UTSW 5 118593550 missense possibly damaging 0.95
R5057:Med13l UTSW 5 118718493 missense probably damaging 1.00
R5369:Med13l UTSW 5 118724010 missense probably benign 0.02
R5446:Med13l UTSW 5 118742397 missense possibly damaging 0.81
R5564:Med13l UTSW 5 118742040 missense probably damaging 1.00
R5566:Med13l UTSW 5 118728665 missense possibly damaging 0.95
R5580:Med13l UTSW 5 118751630 missense possibly damaging 0.95
R5634:Med13l UTSW 5 118560850 missense possibly damaging 0.88
R5748:Med13l UTSW 5 118593445 missense probably damaging 1.00
R5764:Med13l UTSW 5 118728642 missense probably damaging 0.99
R5765:Med13l UTSW 5 118728642 missense probably damaging 0.99
R6083:Med13l UTSW 5 118721486 missense possibly damaging 0.80
R6504:Med13l UTSW 5 118754321 missense probably benign 0.34
R6546:Med13l UTSW 5 118721474 missense probably damaging 1.00
R6797:Med13l UTSW 5 118759264 critical splice donor site probably null
R6911:Med13l UTSW 5 118755658 missense possibly damaging 0.95
R6942:Med13l UTSW 5 118745006 splice site probably null
R7018:Med13l UTSW 5 118751986 missense probably damaging 0.99
R7096:Med13l UTSW 5 118721926 missense possibly damaging 0.90
R7113:Med13l UTSW 5 118726265 missense probably benign 0.09
R7136:Med13l UTSW 5 118721522 missense possibly damaging 0.90
R7140:Med13l UTSW 5 118741972 missense probably benign 0.27
R7409:Med13l UTSW 5 118754321 missense probably benign 0.34
R7410:Med13l UTSW 5 118560832 missense possibly damaging 0.94
R7432:Med13l UTSW 5 118751938 missense probably damaging 0.99
R7486:Med13l UTSW 5 118728474 missense probably benign 0.17
R7509:Med13l UTSW 5 118748930 missense probably damaging 0.97
R7722:Med13l UTSW 5 118747407 missense probably benign 0.32
R7802:Med13l UTSW 5 118728590 missense probably benign 0.03
R8081:Med13l UTSW 5 118728268 missense probably damaging 1.00
R8260:Med13l UTSW 5 118748729 missense possibly damaging 0.95
R8266:Med13l UTSW 5 118742109 missense probably damaging 1.00
R8347:Med13l UTSW 5 118742597 missense probably benign
R8365:Med13l UTSW 5 118728644 missense possibly damaging 0.81
R8508:Med13l UTSW 5 118754321 missense probably benign 0.34
R8920:Med13l UTSW 5 118747478 nonsense probably null
R8970:Med13l UTSW 5 118745099 missense probably damaging 1.00
R8994:Med13l UTSW 5 118728161 missense possibly damaging 0.78
R9045:Med13l UTSW 5 118742751 missense probably benign
X0065:Med13l UTSW 5 118729883 missense probably damaging 1.00
Z1088:Med13l UTSW 5 118749641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCAGAATCAGCACACGCAG -3'
(R):5'- GGCAGTTACTTGTCCTCAAAAGC -3'

Sequencing Primer
(F):5'- GGATTACATCTCCTCCGCCAATC -3'
(R):5'- CTTGTCCTCAAAAGCTTAAGCAG -3'
Posted On2019-09-13