Mutagenetix > Incidental Mutation

Incidental Mutation 'R7345:Med13l'

570137

Institutional Source

Beutler Lab

Gene Symbol

Med13l

Ensembl Gene

ENSMUSG00000018076

Gene Name

mediator complex subunit 13-like

Synonyms

9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R7345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118560679-118765438 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118742760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1306 (W1306R)

Ref Sequence

ENSEMBL: ENSMUSP00000098379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000100816
AA Change: W1306R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: W1306R

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	2.5e-116	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2197	1e-142	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201010
AA Change: W1306R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: W1306R

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	1e-112	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2206	1.7e-138	PFAM

Meta Mutation Damage Score

0.9546

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks3	A	G	16: 4,955,910	M174T	possibly damaging	Het
Arhgap23	G	A	11: 97,466,478	R934Q	possibly damaging	Het
Atad5	T	C	11: 80,096,006	S640P	probably damaging	Het
B3galnt2	C	T	13: 13,980,480		probably null	Het
B430305J03Rik	T	C	3: 61,364,118	S69G	unknown	Het
C87499	T	C	4: 88,628,179	K309E	possibly damaging	Het
Cd163	A	T	6: 124,318,938	N747I	possibly damaging	Het
Cep126	A	G	9: 8,099,816	S906P	probably damaging	Het
Cyp4f39	G	A	17: 32,486,779	G318R	probably damaging	Het
D630003M21Rik	C	T	2: 158,217,209	G257D	probably damaging	Het
Dcaf10	T	C	4: 45,342,583	L139P	probably damaging	Het
Dcc	A	G	18: 71,378,824	V840A	probably benign	Het
Dnhd1	A	T	7: 105,703,967	I2776L	probably benign	Het
Fam166b	T	C	4: 43,428,022	D145G	possibly damaging	Het
Fbxo24	G	T	5: 137,621,261	F234L	probably damaging	Het
Gm21190	T	C	5: 15,527,904		probably null	Het
Grhl3	C	T	4: 135,546,246	R565Q	probably damaging	Het
Gtf3c1	A	T	7: 125,645,670	Y1731N	probably damaging	Het
Il1a	C	A	2: 129,304,773	R133S	probably benign	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Klc3	G	A	7: 19,394,889	T481M	probably benign	Het
Map2k6	A	T	11: 110,492,908	I127F		Het
Mapk8	A	T	14: 33,408,111	N63K	probably damaging	Het
Megf6	C	A	4: 154,267,315	Q1162K	probably benign	Het
Myo5b	A	G	18: 74,708,024	E992G	possibly damaging	Het
Ndst4	C	T	3: 125,714,659	T291M	probably benign	Het
Nek10	T	A	14: 14,955,503	F838L	probably benign	Het
Nrm	A	G	17: 35,864,584	H194R	probably damaging	Het
Nup188	T	C	2: 30,340,601	S1384P	probably benign	Het
Olfml2a	C	A	2: 38,960,127	D618E	probably damaging	Het
Olfr466	A	C	13: 65,152,743	N173T	possibly damaging	Het
Olfr506	C	T	7: 108,613,063	T252I	probably benign	Het
Olfr937	A	G	9: 39,060,579	L29P	probably damaging	Het
Olfr938	G	A	9: 39,078,334	S137F	probably damaging	Het
P2ry1	T	C	3: 61,003,674	F78S	possibly damaging	Het
Pcdhb18	T	C	18: 37,491,923	F769L	probably benign	Het
Poc5	A	G	13: 96,396,796	E144G	probably damaging	Het
Pole	T	A	5: 110,303,903	N870K	possibly damaging	Het
Polr2b	T	C	5: 77,349,119	F1159L	possibly damaging	Het
Rubcnl	A	G	14: 75,042,353	Y392C	probably benign	Het
Sec31a	T	C	5: 100,385,270	T539A	probably damaging	Het
Serpinh1	A	C	7: 99,346,356	S340A	probably damaging	Het
Slc1a5	T	A	7: 16,796,160		probably null	Het
Soat2	A	G	15: 102,162,578	D469G	probably benign	Het
Speg	T	C	1: 75,384,835	L70P	probably damaging	Het
Spred2	T	C	11: 19,924,958		probably null	Het
Stac2	A	C	11: 98,042,613	S168A	probably damaging	Het
Stx1a	T	A	5: 135,037,188	D31E	probably benign	Het
Timeless	C	T	10: 128,249,754	T885M	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tsen34	T	C	7: 3,695,615	Y253H	probably damaging	Het
Unc13b	T	C	4: 43,173,966	V1598A	unknown	Het
Zfat	A	T	15: 68,105,043	Y1086N	probably damaging	Het
Zfp551	G	A	7: 12,416,595	H296Y	probably benign	Het

Other mutations in Med13l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Med13l	APN	5	118724071	missense	probably damaging	0.99
IGL01012:Med13l	APN	5	118734028	missense	probably damaging	0.99
IGL01316:Med13l	APN	5	118762781	missense	probably damaging	1.00
IGL01529:Med13l	APN	5	118742335	missense	probably damaging	1.00
IGL01731:Med13l	APN	5	118742407	missense	probably benign	0.05
IGL01790:Med13l	APN	5	118593522	missense	probably damaging	1.00
IGL02394:Med13l	APN	5	118748833	missense	probably benign	0.37
IGL02432:Med13l	APN	5	118738400	missense	possibly damaging	0.90
IGL02698:Med13l	APN	5	118762829	missense	probably damaging	0.99
IGL02801:Med13l	APN	5	118745113	missense	probably damaging	1.00
IGL03242:Med13l	APN	5	118747445	missense	probably benign
IGL03270:Med13l	APN	5	118731430	missense	probably damaging	1.00
Basics	UTSW	5	118759264	critical splice donor site	probably null
firmament	UTSW	5	118745006	splice site	probably null
Fundament	UTSW	5	118721474	missense	probably damaging	1.00
Root	UTSW	5	118593445	missense	probably damaging	1.00
P0035:Med13l	UTSW	5	118742620	missense	probably benign	0.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0136:Med13l	UTSW	5	118724050	missense	probably benign	0.15
R0158:Med13l	UTSW	5	118742449	missense	unknown
R0197:Med13l	UTSW	5	118671002	splice site	probably benign
R0370:Med13l	UTSW	5	118741826	missense	probably benign	0.14
R0492:Med13l	UTSW	5	118738495	missense	probably damaging	1.00
R0532:Med13l	UTSW	5	118759123	missense	possibly damaging	0.78
R0726:Med13l	UTSW	5	118748684	missense	probably damaging	0.99
R0738:Med13l	UTSW	5	118751633	missense	probably damaging	0.99
R0827:Med13l	UTSW	5	118726247	splice site	probably benign
R0883:Med13l	UTSW	5	118671002	splice site	probably benign
R0959:Med13l	UTSW	5	118754285	missense	possibly damaging	0.89
R1458:Med13l	UTSW	5	118738459	missense	probably benign	0.00
R1562:Med13l	UTSW	5	118738519	missense	probably damaging	1.00
R1577:Med13l	UTSW	5	118721392	missense	probably damaging	1.00
R1661:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1665:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1720:Med13l	UTSW	5	118741995	missense	probably damaging	1.00
R1929:Med13l	UTSW	5	118728833	missense	probably benign	0.01
R1967:Med13l	UTSW	5	118761322	missense	probably damaging	0.99
R2301:Med13l	UTSW	5	118593447	missense	probably damaging	1.00
R3691:Med13l	UTSW	5	118721497	missense	probably benign	0.16
R3895:Med13l	UTSW	5	118761323	missense	probably null	0.99
R4043:Med13l	UTSW	5	118593463	missense	probably damaging	1.00
R4593:Med13l	UTSW	5	118742560	missense	probably damaging	1.00
R4902:Med13l	UTSW	5	118745130	missense	probably damaging	1.00
R4995:Med13l	UTSW	5	118730949	missense	possibly damaging	0.90
R5010:Med13l	UTSW	5	118593550	missense	possibly damaging	0.95
R5057:Med13l	UTSW	5	118718493	missense	probably damaging	1.00
R5369:Med13l	UTSW	5	118724010	missense	probably benign	0.02
R5446:Med13l	UTSW	5	118742397	missense	possibly damaging	0.81
R5564:Med13l	UTSW	5	118742040	missense	probably damaging	1.00
R5566:Med13l	UTSW	5	118728665	missense	possibly damaging	0.95
R5580:Med13l	UTSW	5	118751630	missense	possibly damaging	0.95
R5634:Med13l	UTSW	5	118560850	missense	possibly damaging	0.88
R5748:Med13l	UTSW	5	118593445	missense	probably damaging	1.00
R5764:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R5765:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R6083:Med13l	UTSW	5	118721486	missense	possibly damaging	0.80
R6504:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R6546:Med13l	UTSW	5	118721474	missense	probably damaging	1.00
R6797:Med13l	UTSW	5	118759264	critical splice donor site	probably null
R6911:Med13l	UTSW	5	118755658	missense	possibly damaging	0.95
R6942:Med13l	UTSW	5	118745006	splice site	probably null
R7018:Med13l	UTSW	5	118751986	missense	probably damaging	0.99
R7096:Med13l	UTSW	5	118721926	missense	possibly damaging	0.90
R7113:Med13l	UTSW	5	118726265	missense	probably benign	0.09
R7136:Med13l	UTSW	5	118721522	missense	possibly damaging	0.90
R7140:Med13l	UTSW	5	118741972	missense	probably benign	0.27
R7409:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R7410:Med13l	UTSW	5	118560832	missense	possibly damaging	0.94
R7432:Med13l	UTSW	5	118751938	missense	probably damaging	0.99
R7486:Med13l	UTSW	5	118728474	missense	probably benign	0.17
R7509:Med13l	UTSW	5	118748930	missense	probably damaging	0.97
R7722:Med13l	UTSW	5	118747407	missense	probably benign	0.32
R7802:Med13l	UTSW	5	118728590	missense	probably benign	0.03
R8081:Med13l	UTSW	5	118728268	missense	probably damaging	1.00
R8260:Med13l	UTSW	5	118748729	missense	possibly damaging	0.95
R8266:Med13l	UTSW	5	118742109	missense	probably damaging	1.00
R8347:Med13l	UTSW	5	118742597	missense	probably benign
R8365:Med13l	UTSW	5	118728644	missense	possibly damaging	0.81
R8508:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R8920:Med13l	UTSW	5	118747478	nonsense	probably null
R8970:Med13l	UTSW	5	118745099	missense	probably damaging	1.00
R8994:Med13l	UTSW	5	118728161	missense	possibly damaging	0.78
R9045:Med13l	UTSW	5	118742751	missense	probably benign
R9401:Med13l	UTSW	5	118745024	missense	probably benign	0.14
R9445:Med13l	UTSW	5	118724149	missense	probably benign	0.00
R9446:Med13l	UTSW	5	118738502	missense	probably benign	0.11
R9714:Med13l	UTSW	5	118728373	missense	probably benign	0.44
R9777:Med13l	UTSW	5	118748959	missense	probably benign
R9781:Med13l	UTSW	5	118729967	missense	possibly damaging	0.60
R9797:Med13l	UTSW	5	118742079	missense	probably damaging	1.00
X0065:Med13l	UTSW	5	118729883	missense	probably damaging	1.00
Z1088:Med13l	UTSW	5	118749641	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTCAGAATCAGCACACGCAG -3'
(R):5'- GGCAGTTACTTGTCCTCAAAAGC -3'

Sequencing Primer
(F):5'- GGATTACATCTCCTCCGCCAATC -3'
(R):5'- CTTGTCCTCAAAAGCTTAAGCAG -3'

Posted On

2019-09-13