Incidental Mutation 'R7345:Stx1a'
ID570138
Institutional Source Beutler Lab
Gene Symbol Stx1a
Ensembl Gene ENSMUSG00000007207
Gene Namesyntaxin 1A (brain)
SynonymsHPC-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135023482-135051100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135037188 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 31 (D31E)
Ref Sequence ENSEMBL: ENSMUSP00000005509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005509] [ENSMUST00000150838] [ENSMUST00000201008]
Predicted Effect probably benign
Transcript: ENSMUST00000005509
AA Change: D31E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000005509
Gene: ENSMUSG00000007207
AA Change: D31E

DomainStartEndE-ValueType
SynN 25 146 4.44e-42 SMART
t_SNARE 187 254 3.28e-24 SMART
transmembrane domain 266 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150838
AA Change: D31E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117144
Gene: ENSMUSG00000007207
AA Change: D31E

DomainStartEndE-ValueType
SynN 25 146 4.44e-42 SMART
Pfam:SNARE 197 231 6.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201008
AA Change: D31E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144082
Gene: ENSMUSG00000007207
AA Change: D31E

DomainStartEndE-ValueType
SynN 25 121 1.3e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin superfamily. Syntaxins are nervous system-specific proteins implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. Syntaxins possess a single C-terminal transmembrane domain, a SNARE [Soluble NSF (N-ethylmaleimide-sensitive fusion protein)-Attachment protein REceptor] domain (known as H3), and an N-terminal regulatory domain (Habc). Syntaxins bind synaptotagmin in a calcium-dependent fashion and interact with voltage dependent calcium and potassium channels via the C-terminal H3 domain. This gene product is a key molecule in ion channel regulation and synaptic exocytosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mice for one targeted mutation display impairments in LTP, cued fear memory consolidation and cued fear memory extinction while mice with another targeted mutation show no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Stx1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Stx1a APN 5 135045664 missense probably damaging 0.99
IGL01956:Stx1a APN 5 135037469 splice site probably benign
IGL02448:Stx1a APN 5 135023619 splice site probably benign
R0140:Stx1a UTSW 5 135045585 splice site probably benign
R0840:Stx1a UTSW 5 135041234 intron probably benign
R5810:Stx1a UTSW 5 135049078 missense probably damaging 0.99
R7536:Stx1a UTSW 5 135049840 missense probably damaging 1.00
R8085:Stx1a UTSW 5 135037577 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTACTGGTAGGGGACATGG -3'
(R):5'- TCAAACTGGCTCACACTGG -3'

Sequencing Primer
(F):5'- CAGGTTGTCTGTCTCTGGGACTC -3'
(R):5'- ACTGGCTCACACTGGAGCAC -3'
Posted On2019-09-13