Incidental Mutation 'R7345:Zfp551'
ID 570142
Institutional Source Beutler Lab
Gene Symbol Zfp551
Ensembl Gene ENSMUSG00000034071
Gene Name zinc fingr protein 551
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7345 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12415153-12422751 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12416595 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 296 (H296Y)
Ref Sequence ENSEMBL: ENSMUSP00000079222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080348] [ENSMUST00000120220]
AlphaFold B2RUI1
Predicted Effect probably benign
Transcript: ENSMUST00000080348
AA Change: H296Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079222
Gene: ENSMUSG00000034071
AA Change: H296Y

DomainStartEndE-ValueType
KRAB 48 109 2.3e-14 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.47e-3 SMART
ZnF_C2H2 393 415 3.69e-4 SMART
ZnF_C2H2 421 443 1.22e-4 SMART
ZnF_C2H2 449 471 3.11e-2 SMART
ZnF_C2H2 477 499 3.44e-4 SMART
ZnF_C2H2 505 527 9.73e-4 SMART
ZnF_C2H2 533 555 1.6e-4 SMART
ZnF_C2H2 561 583 1.38e-3 SMART
ZnF_C2H2 589 611 8.47e-4 SMART
ZnF_C2H2 617 639 6.99e-5 SMART
ZnF_C2H2 645 667 2.09e-3 SMART
ZnF_C2H2 673 695 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120220
Predicted Effect probably benign
Transcript: ENSMUST00000123877
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Other mutations in Zfp551
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Zfp551 APN 7 12418541 critical splice donor site probably null
IGL01990:Zfp551 APN 7 12422416 missense possibly damaging 0.90
IGL02511:Zfp551 APN 7 12416675 missense possibly damaging 0.70
R2001:Zfp551 UTSW 7 12416349 missense probably damaging 1.00
R3120:Zfp551 UTSW 7 12416016 missense possibly damaging 0.94
R4256:Zfp551 UTSW 7 12416391 missense possibly damaging 0.95
R4387:Zfp551 UTSW 7 12418641 missense probably damaging 1.00
R5314:Zfp551 UTSW 7 12416160 nonsense probably null
R5536:Zfp551 UTSW 7 12415561 missense possibly damaging 0.86
R5874:Zfp551 UTSW 7 12416174 missense probably damaging 1.00
R6265:Zfp551 UTSW 7 12415412 missense probably damaging 1.00
R6765:Zfp551 UTSW 7 12416840 missense possibly damaging 0.85
R6803:Zfp551 UTSW 7 12417181 nonsense probably null
R6953:Zfp551 UTSW 7 12416788 nonsense probably null
R7334:Zfp551 UTSW 7 12416754 missense probably damaging 0.97
R7502:Zfp551 UTSW 7 12415798 nonsense probably null
R7772:Zfp551 UTSW 7 12418608 missense probably damaging 0.98
R7776:Zfp551 UTSW 7 12418642 missense probably damaging 1.00
R7999:Zfp551 UTSW 7 12417211 nonsense probably null
R8032:Zfp551 UTSW 7 12418560 missense possibly damaging 0.82
R8984:Zfp551 UTSW 7 12422632 unclassified probably benign
R9082:Zfp551 UTSW 7 12417077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGTCTCTGATGGTAAACGAG -3'
(R):5'- AACAGCAAGCCACTTGTATTCG -3'

Sequencing Primer
(F):5'- TCTCTGATGGTAAACGAGTTCAG -3'
(R):5'- TCGTGAACAGCCTTATAGCAGTG -3'
Posted On 2019-09-13