Incidental Mutation 'R7345:Serpinh1'
ID570145
Institutional Source Beutler Lab
Gene Symbol Serpinh1
Ensembl Gene ENSMUSG00000070436
Gene Nameserine (or cysteine) peptidase inhibitor, clade H, member 1
SynonymsHsp47, gp46, Cbp2, Serpinh2, Cbp1, colligin, J6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location99345376-99353239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 99346356 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 340 (S340A)
Ref Sequence ENSEMBL: ENSMUSP00000091706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094154] [ENSMUST00000169437] [ENSMUST00000207849] [ENSMUST00000207989] [ENSMUST00000208119] [ENSMUST00000208292] [ENSMUST00000208749]
Predicted Effect probably damaging
Transcript: ENSMUST00000094154
AA Change: S340A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091706
Gene: ENSMUSG00000070436
AA Change: S340A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169437
AA Change: S340A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126390
Gene: ENSMUSG00000070436
AA Change: S340A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 51 408 6.88e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207849
AA Change: S340A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000207989
Predicted Effect probably damaging
Transcript: ENSMUST00000208119
AA Change: S340A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000208292
Predicted Effect probably benign
Transcript: ENSMUST00000208749
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E11.5. Mice homozygous for a conditional allele activated in chondrocytes exhibit complete perinatal lethality, cleft palate, respiratory distress, abnormal chondocytes and bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Serpinh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02405:Serpinh1 APN 7 99347334 missense possibly damaging 0.94
IGL02506:Serpinh1 APN 7 99346992 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0070:Serpinh1 UTSW 7 99349314 missense probably damaging 1.00
R0608:Serpinh1 UTSW 7 99349394 missense unknown
R1338:Serpinh1 UTSW 7 99348911 missense probably damaging 1.00
R1612:Serpinh1 UTSW 7 99348931 missense probably damaging 0.97
R1916:Serpinh1 UTSW 7 99349081 missense probably damaging 1.00
R2321:Serpinh1 UTSW 7 99346385 missense probably damaging 1.00
R2886:Serpinh1 UTSW 7 99349021 missense probably damaging 1.00
R4176:Serpinh1 UTSW 7 99346999 missense probably benign
R5860:Serpinh1 UTSW 7 99346364 missense probably damaging 1.00
R7884:Serpinh1 UTSW 7 99349288 missense probably benign 0.00
R8215:Serpinh1 UTSW 7 99346338 missense possibly damaging 0.58
R8309:Serpinh1 UTSW 7 99348944 missense possibly damaging 0.94
RF005:Serpinh1 UTSW 7 99346203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTCTGATTATCTCGCACCAG -3'
(R):5'- GTCCTGGTGGTATACAGAGGAAC -3'

Sequencing Primer
(F):5'- CTGATTATCTCGCACCAGGAAGATG -3'
(R):5'- GGTTTGCAGCACTTCCGC -3'
Posted On2019-09-13