Incidental Mutation 'R7345:Dnhd1'
ID 570146
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Name dynein heavy chain domain 1
Synonyms 8030491N06Rik
MMRRC Submission 045379-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7345 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 105300034-105371006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105353174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 2776 (I2776L)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145988]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000145988
AA Change: I2776L

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: I2776L

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,773,774 (GRCm39) M174T possibly damaging Het
Arhgap23 G A 11: 97,357,304 (GRCm39) R934Q possibly damaging Het
Atad5 T C 11: 79,986,832 (GRCm39) S640P probably damaging Het
B3galnt2 C T 13: 14,155,065 (GRCm39) probably null Het
B430305J03Rik T C 3: 61,271,539 (GRCm39) S69G unknown Het
Cd163 A T 6: 124,295,897 (GRCm39) N747I possibly damaging Het
Cep126 A G 9: 8,099,817 (GRCm39) S906P probably damaging Het
Cimip2b T C 4: 43,428,022 (GRCm39) D145G possibly damaging Het
Cyp4f39 G A 17: 32,705,753 (GRCm39) G318R probably damaging Het
D630003M21Rik C T 2: 158,059,129 (GRCm39) G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 (GRCm39) L139P probably damaging Het
Dcc A G 18: 71,511,895 (GRCm39) V840A probably benign Het
Fbxo24 G T 5: 137,619,523 (GRCm39) F234L probably damaging Het
Gm21190 T C 5: 15,732,902 (GRCm39) probably null Het
Grhl3 C T 4: 135,273,557 (GRCm39) R565Q probably damaging Het
Gtf3c1 A T 7: 125,244,842 (GRCm39) Y1731N probably damaging Het
Il1a C A 2: 129,146,693 (GRCm39) R133S probably benign Het
Ipo4 C T 14: 55,872,988 (GRCm39) R23Q probably benign Het
Klc3 G A 7: 19,128,814 (GRCm39) T481M probably benign Het
Map2k6 A T 11: 110,383,734 (GRCm39) I127F Het
Mapk8 A T 14: 33,130,068 (GRCm39) N63K probably damaging Het
Med13l T C 5: 118,880,825 (GRCm39) W1306R probably damaging Het
Megf6 C A 4: 154,351,772 (GRCm39) Q1162K probably benign Het
Myo5b A G 18: 74,841,095 (GRCm39) E992G possibly damaging Het
Ndst4 C T 3: 125,508,308 (GRCm39) T291M probably benign Het
Nek10 T A 14: 14,955,503 (GRCm38) F838L probably benign Het
Nrm A G 17: 36,175,476 (GRCm39) H194R probably damaging Het
Nup188 T C 2: 30,230,613 (GRCm39) S1384P probably benign Het
Olfml2a C A 2: 38,850,139 (GRCm39) D618E probably damaging Het
Or5p78 C T 7: 108,212,270 (GRCm39) T252I probably benign Het
Or8g23 A G 9: 38,971,875 (GRCm39) L29P probably damaging Het
Or8g24 G A 9: 38,989,630 (GRCm39) S137F probably damaging Het
Or9s18 A C 13: 65,300,557 (GRCm39) N173T possibly damaging Het
P2ry1 T C 3: 60,911,095 (GRCm39) F78S possibly damaging Het
Pcdhb18 T C 18: 37,624,976 (GRCm39) F769L probably benign Het
Poc5 A G 13: 96,533,304 (GRCm39) E144G probably damaging Het
Pole T A 5: 110,451,769 (GRCm39) N870K possibly damaging Het
Polr2b T C 5: 77,496,966 (GRCm39) F1159L possibly damaging Het
Pramel32 T C 4: 88,546,416 (GRCm39) K309E possibly damaging Het
Rubcnl A G 14: 75,279,793 (GRCm39) Y392C probably benign Het
Sec31a T C 5: 100,533,129 (GRCm39) T539A probably damaging Het
Serpinh1 A C 7: 98,995,563 (GRCm39) S340A probably damaging Het
Slc1a5 T A 7: 16,530,085 (GRCm39) probably null Het
Soat2 A G 15: 102,071,013 (GRCm39) D469G probably benign Het
Speg T C 1: 75,361,479 (GRCm39) L70P probably damaging Het
Spred2 T C 11: 19,874,958 (GRCm39) probably null Het
Stac2 A C 11: 97,933,439 (GRCm39) S168A probably damaging Het
Stx1a T A 5: 135,066,042 (GRCm39) D31E probably benign Het
Timeless C T 10: 128,085,623 (GRCm39) T885M probably damaging Het
Tmem94 G T 11: 115,677,082 (GRCm39) R118L possibly damaging Het
Tsen34 T C 7: 3,698,614 (GRCm39) Y253H probably damaging Het
Unc13b T C 4: 43,173,966 (GRCm39) V1598A unknown Het
Zfat A T 15: 67,976,892 (GRCm39) Y1086N probably damaging Het
Zfp551 G A 7: 12,150,522 (GRCm39) H296Y probably benign Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105,327,202 (GRCm39) missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105,306,418 (GRCm39) missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105,341,882 (GRCm39) missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105,370,895 (GRCm39) missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105,363,116 (GRCm39) missense probably benign
IGL01714:Dnhd1 APN 7 105,370,149 (GRCm39) missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105,362,961 (GRCm39) missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105,301,237 (GRCm39) missense probably benign
IGL01999:Dnhd1 APN 7 105,370,422 (GRCm39) missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105,327,516 (GRCm39) missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105,370,009 (GRCm39) missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105,370,951 (GRCm39) missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105,370,688 (GRCm39) missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105,369,948 (GRCm39) missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105,369,089 (GRCm39) missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105,363,682 (GRCm39) missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105,362,940 (GRCm39) missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105,304,930 (GRCm39) missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105,370,131 (GRCm39) missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105,370,738 (GRCm39) missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105,369,321 (GRCm39) missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105,343,602 (GRCm39) missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105,363,252 (GRCm39) missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105,369,995 (GRCm39) missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105,344,958 (GRCm39) missense probably benign
R0669:Dnhd1 UTSW 7 105,342,911 (GRCm39) missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105,345,671 (GRCm39) missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105,301,113 (GRCm39) missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105,358,378 (GRCm39) missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105,362,238 (GRCm39) missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105,346,106 (GRCm39) missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105,343,360 (GRCm39) missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105,369,331 (GRCm39) missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105,370,480 (GRCm39) critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105,317,670 (GRCm39) missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105,342,867 (GRCm39) missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105,353,355 (GRCm39) missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105,362,913 (GRCm39) missense possibly damaging 0.74
R1615:Dnhd1 UTSW 7 105,352,413 (GRCm39) missense probably benign 0.00
R1656:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105,343,035 (GRCm39) missense probably benign
R1723:Dnhd1 UTSW 7 105,364,127 (GRCm39) missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105,343,179 (GRCm39) missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105,304,974 (GRCm39) missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105,353,412 (GRCm39) missense probably benign
R1920:Dnhd1 UTSW 7 105,362,614 (GRCm39) missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105,323,061 (GRCm39) missense probably damaging 0.96
R1925:Dnhd1 UTSW 7 105,301,459 (GRCm39) missense probably damaging 1.00
R1934:Dnhd1 UTSW 7 105,357,789 (GRCm39) missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105,323,183 (GRCm39) missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105,354,128 (GRCm39) missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105,327,178 (GRCm39) missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105,342,928 (GRCm39) missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105,352,979 (GRCm39) missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105,354,606 (GRCm39) missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105,323,628 (GRCm39) missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105,359,297 (GRCm39) missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105,352,674 (GRCm39) missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105,342,871 (GRCm39) missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105,369,438 (GRCm39) missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105,361,766 (GRCm39) missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105,369,436 (GRCm39) missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105,345,772 (GRCm39) critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3405:Dnhd1 UTSW 7 105,343,968 (GRCm39) nonsense probably null
R3439:Dnhd1 UTSW 7 105,343,992 (GRCm39) missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105,362,329 (GRCm39) missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105,364,045 (GRCm39) missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105,358,795 (GRCm39) missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105,362,205 (GRCm39) missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105,343,161 (GRCm39) missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105,345,935 (GRCm39) nonsense probably null
R4565:Dnhd1 UTSW 7 105,301,163 (GRCm39) missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105,306,373 (GRCm39) splice site probably null
R4584:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105,327,256 (GRCm39) missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105,363,237 (GRCm39) missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105,364,653 (GRCm39) missense probably benign 0.02
R4600:Dnhd1 UTSW 7 105,352,851 (GRCm39) missense probably damaging 1.00
R4705:Dnhd1 UTSW 7 105,304,948 (GRCm39) missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105,323,056 (GRCm39) missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105,323,651 (GRCm39) missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105,370,324 (GRCm39) missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105,363,488 (GRCm39) missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105,353,171 (GRCm39) missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105,364,015 (GRCm39) missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105,306,164 (GRCm39) missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105,362,840 (GRCm39) missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105,362,283 (GRCm39) missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105,342,904 (GRCm39) missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105,362,647 (GRCm39) missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105,363,759 (GRCm39) missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105,345,667 (GRCm39) missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105,353,130 (GRCm39) missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105,334,968 (GRCm39) missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5258:Dnhd1 UTSW 7 105,323,244 (GRCm39) missense probably benign
R5273:Dnhd1 UTSW 7 105,363,689 (GRCm39) missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105,363,644 (GRCm39) missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105,362,891 (GRCm39) missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105,363,363 (GRCm39) missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105,364,028 (GRCm39) missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105,352,416 (GRCm39) missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105,323,395 (GRCm39) missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105,354,217 (GRCm39) missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105,304,981 (GRCm39) missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105,369,102 (GRCm39) missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105,369,388 (GRCm39) missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105,344,955 (GRCm39) missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105,369,711 (GRCm39) missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105,363,194 (GRCm39) missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105,358,647 (GRCm39) missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105,353,255 (GRCm39) missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105,301,216 (GRCm39) missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105,342,577 (GRCm39) missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105,343,273 (GRCm39) missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105,327,093 (GRCm39) missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105,353,006 (GRCm39) missense probably benign
R6663:Dnhd1 UTSW 7 105,334,899 (GRCm39) splice site probably null
R6730:Dnhd1 UTSW 7 105,353,082 (GRCm39) missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105,369,844 (GRCm39) missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105,352,580 (GRCm39) missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105,369,137 (GRCm39) missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105,352,935 (GRCm39) missense probably benign
R6860:Dnhd1 UTSW 7 105,327,473 (GRCm39) missense probably benign
R6898:Dnhd1 UTSW 7 105,336,584 (GRCm39) missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105,364,770 (GRCm39) missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105,362,895 (GRCm39) missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105,353,792 (GRCm39) missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105,363,417 (GRCm39) missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105,370,005 (GRCm39) missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105,344,161 (GRCm39) missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105,364,468 (GRCm39) missense probably benign 0.26
R7086:Dnhd1 UTSW 7 105,357,739 (GRCm39) missense probably benign 0.03
R7112:Dnhd1 UTSW 7 105,363,192 (GRCm39) missense probably damaging 1.00
R7140:Dnhd1 UTSW 7 105,342,973 (GRCm39) missense probably benign 0.00
R7151:Dnhd1 UTSW 7 105,359,234 (GRCm39) missense probably benign 0.03
R7178:Dnhd1 UTSW 7 105,344,200 (GRCm39) missense probably damaging 0.98
R7326:Dnhd1 UTSW 7 105,370,137 (GRCm39) missense probably damaging 0.96
R7349:Dnhd1 UTSW 7 105,359,330 (GRCm39) missense probably damaging 1.00
R7397:Dnhd1 UTSW 7 105,354,504 (GRCm39) missense possibly damaging 0.87
R7520:Dnhd1 UTSW 7 105,345,255 (GRCm39) missense probably benign 0.07
R7536:Dnhd1 UTSW 7 105,358,768 (GRCm39) missense probably damaging 1.00
R7539:Dnhd1 UTSW 7 105,370,119 (GRCm39) missense probably damaging 1.00
R7541:Dnhd1 UTSW 7 105,327,516 (GRCm39) missense probably damaging 1.00
R7619:Dnhd1 UTSW 7 105,323,475 (GRCm39) missense probably benign 0.01
R7676:Dnhd1 UTSW 7 105,333,294 (GRCm39) missense probably benign 0.09
R7689:Dnhd1 UTSW 7 105,363,170 (GRCm39) missense probably benign 0.07
R7712:Dnhd1 UTSW 7 105,300,831 (GRCm39) missense probably benign 0.17
R7729:Dnhd1 UTSW 7 105,354,472 (GRCm39) missense probably damaging 1.00
R7767:Dnhd1 UTSW 7 105,343,817 (GRCm39) missense probably benign 0.38
R7768:Dnhd1 UTSW 7 105,370,302 (GRCm39) missense possibly damaging 0.87
R7779:Dnhd1 UTSW 7 105,327,122 (GRCm39) missense probably benign 0.01
R7879:Dnhd1 UTSW 7 105,352,646 (GRCm39) missense probably benign 0.09
R7922:Dnhd1 UTSW 7 105,317,721 (GRCm39) missense probably damaging 1.00
R7951:Dnhd1 UTSW 7 105,327,211 (GRCm39) missense probably damaging 1.00
R8259:Dnhd1 UTSW 7 105,343,995 (GRCm39) missense probably benign 0.38
R8350:Dnhd1 UTSW 7 105,327,231 (GRCm39) missense probably damaging 0.99
R8380:Dnhd1 UTSW 7 105,327,073 (GRCm39) missense probably benign 0.31
R8392:Dnhd1 UTSW 7 105,352,550 (GRCm39) missense possibly damaging 0.84
R8478:Dnhd1 UTSW 7 105,332,001 (GRCm39) missense probably benign 0.00
R8708:Dnhd1 UTSW 7 105,343,487 (GRCm39) nonsense probably null
R8767:Dnhd1 UTSW 7 105,301,330 (GRCm39) missense probably damaging 1.00
R8825:Dnhd1 UTSW 7 105,343,174 (GRCm39) missense possibly damaging 0.95
R8849:Dnhd1 UTSW 7 105,370,723 (GRCm39) missense probably benign 0.00
R8903:Dnhd1 UTSW 7 105,362,855 (GRCm39) nonsense probably null
R8910:Dnhd1 UTSW 7 105,332,904 (GRCm39) missense possibly damaging 0.92
R8940:Dnhd1 UTSW 7 105,363,854 (GRCm39) intron probably benign
R8954:Dnhd1 UTSW 7 105,343,986 (GRCm39) missense probably benign 0.35
R8956:Dnhd1 UTSW 7 105,341,852 (GRCm39) missense probably damaging 0.99
R8971:Dnhd1 UTSW 7 105,358,528 (GRCm39) nonsense probably null
R8996:Dnhd1 UTSW 7 105,323,242 (GRCm39) missense probably damaging 1.00
R9051:Dnhd1 UTSW 7 105,341,933 (GRCm39) missense possibly damaging 0.54
R9058:Dnhd1 UTSW 7 105,333,270 (GRCm39) missense probably benign 0.01
R9109:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9284:Dnhd1 UTSW 7 105,301,091 (GRCm39) missense probably damaging 1.00
R9295:Dnhd1 UTSW 7 105,363,348 (GRCm39) missense probably benign
R9298:Dnhd1 UTSW 7 105,333,173 (GRCm39) missense probably damaging 0.98
R9299:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9308:Dnhd1 UTSW 7 105,353,484 (GRCm39) missense probably damaging 1.00
R9337:Dnhd1 UTSW 7 105,369,806 (GRCm39) missense probably benign 0.00
R9385:Dnhd1 UTSW 7 105,361,972 (GRCm39) missense probably damaging 1.00
R9463:Dnhd1 UTSW 7 105,344,223 (GRCm39) missense probably benign
R9463:Dnhd1 UTSW 7 105,306,454 (GRCm39) missense probably benign 0.00
R9476:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9489:Dnhd1 UTSW 7 105,300,804 (GRCm39) missense probably benign
R9500:Dnhd1 UTSW 7 105,353,709 (GRCm39) missense probably benign
R9510:Dnhd1 UTSW 7 105,352,889 (GRCm39) missense possibly damaging 0.74
R9513:Dnhd1 UTSW 7 105,354,179 (GRCm39) missense probably damaging 1.00
R9537:Dnhd1 UTSW 7 105,344,740 (GRCm39) missense probably damaging 0.99
R9567:Dnhd1 UTSW 7 105,353,473 (GRCm39) missense probably benign 0.03
R9622:Dnhd1 UTSW 7 105,353,342 (GRCm39) missense probably benign
R9623:Dnhd1 UTSW 7 105,344,134 (GRCm39) missense probably damaging 1.00
R9623:Dnhd1 UTSW 7 105,335,773 (GRCm39) missense probably damaging 1.00
R9674:Dnhd1 UTSW 7 105,363,429 (GRCm39) missense probably damaging 1.00
R9756:Dnhd1 UTSW 7 105,353,135 (GRCm39) missense probably benign 0.19
R9777:Dnhd1 UTSW 7 105,369,456 (GRCm39) missense probably benign 0.14
R9778:Dnhd1 UTSW 7 105,353,240 (GRCm39) missense probably benign
R9781:Dnhd1 UTSW 7 105,352,917 (GRCm39) missense probably benign 0.31
R9796:Dnhd1 UTSW 7 105,342,537 (GRCm39) missense probably damaging 1.00
Z1088:Dnhd1 UTSW 7 105,361,934 (GRCm39) missense probably benign 0.00
Z1176:Dnhd1 UTSW 7 105,352,243 (GRCm39) critical splice acceptor site probably null
Z1176:Dnhd1 UTSW 7 105,327,506 (GRCm39) missense probably benign
Z1176:Dnhd1 UTSW 7 105,317,754 (GRCm39) missense probably damaging 0.98
Z1176:Dnhd1 UTSW 7 105,352,787 (GRCm39) frame shift probably null
Z1177:Dnhd1 UTSW 7 105,332,048 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGACCTTAAGCAACAGTGACAGTG -3'
(R):5'- GCAACCAACTGCTTTTCAAGG -3'

Sequencing Primer
(F):5'- CTTAAGCAACAGTGACAGTGGATCAG -3'
(R):5'- GTTGGGACTCTCAAAGTTAGATCCC -3'
Posted On 2019-09-13