Incidental Mutation 'R7345:Olfr937'
ID570150
Institutional Source Beutler Lab
Gene Symbol Olfr937
Ensembl Gene ENSMUSG00000094182
Gene Nameolfactory receptor 937
SynonymsMOR171-24, GA_x6K02T2PVTD-32756567-32755632
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39058851-39064951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39060579 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 29 (L29P)
Ref Sequence ENSEMBL: ENSMUSP00000150274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055567] [ENSMUST00000215049]
Predicted Effect probably damaging
Transcript: ENSMUST00000055567
AA Change: L29P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058346
Gene: ENSMUSG00000094182
AA Change: L29P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 1.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215049
AA Change: L29P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Olfr937
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Olfr937 APN 9 39059863 missense probably benign 0.03
IGL01387:Olfr937 APN 9 39060321 missense probably damaging 1.00
IGL01775:Olfr937 APN 9 39060467 missense probably damaging 1.00
IGL02076:Olfr937 APN 9 39060585 missense probably damaging 1.00
IGL02740:Olfr937 APN 9 39060289 missense probably benign 0.22
IGL03115:Olfr937 APN 9 39059963 missense probably damaging 0.99
R0121:Olfr937 UTSW 9 39059760 missense probably damaging 1.00
R0908:Olfr937 UTSW 9 39059947 missense probably damaging 1.00
R1559:Olfr937 UTSW 9 39060141 missense probably benign 0.20
R2006:Olfr937 UTSW 9 39060433 missense probably damaging 0.99
R2010:Olfr937 UTSW 9 39060099 missense probably benign 0.05
R2191:Olfr937 UTSW 9 39060405 missense probably benign
R3874:Olfr937 UTSW 9 39060174 missense probably benign 0.00
R4970:Olfr937 UTSW 9 39060531 missense probably benign 0.12
R5217:Olfr937 UTSW 9 39059769 missense probably benign 0.00
R5836:Olfr937 UTSW 9 39060622 missense probably benign
R5886:Olfr937 UTSW 9 39060382 missense probably benign 0.00
R6109:Olfr937 UTSW 9 39060196 missense probably benign 0.23
R7261:Olfr937 UTSW 9 39060208 missense possibly damaging 0.64
R7328:Olfr937 UTSW 9 39060561 missense probably damaging 1.00
R7419:Olfr937 UTSW 9 39060169 missense probably benign 0.00
X0022:Olfr937 UTSW 9 39060417 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCATCCAGTGTAGGAAATGATG -3'
(R):5'- AGTGCTCACTGGCAGTATG -3'

Sequencing Primer
(F):5'- CCAGTGTAGGAAATGATGTTTTTCTC -3'
(R):5'- GCTCACTGGCAGTATGTAATGTATC -3'
Posted On2019-09-13