Mutagenetix > Incidental Mutation

Incidental Mutation 'R7345:Atad5'

570154

Institutional Source

Beutler Lab

Gene Symbol

Atad5

Ensembl Gene

ENSMUSG00000017550

Gene Name

ATPase family, AAA domain containing 5

Synonyms

LOC237877, C130052G03Rik

MMRRC Submission

045379-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80089400-80135794 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80096006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 640 (S640P)

Ref Sequence

ENSEMBL: ENSMUSP00000017694 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]

AlphaFold

Q4QY64

Predicted Effect

probably damaging
Transcript: ENSMUST00000017694
AA Change: S640P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: S640P

Domain	Start	End	E-Value	Type
low complexity region	298	311	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	467	486	N/A	INTRINSIC
coiled coil region	665	697	N/A	INTRINSIC
low complexity region	798	807	N/A	INTRINSIC
AAA	1111	1347	5.14e-5	SMART
Blast:AAA	1409	1526	1e-31	BLAST
low complexity region	1573	1583	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108239
AA Change: S640P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: S640P

Domain	Start	End	E-Value	Type
low complexity region	298	311	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	467	486	N/A	INTRINSIC
coiled coil region	665	697	N/A	INTRINSIC
low complexity region	798	807	N/A	INTRINSIC
AAA	1108	1344	5.14e-5	SMART
Blast:AAA	1406	1523	1e-31	BLAST
low complexity region	1570	1580	N/A	INTRINSIC

Meta Mutation Damage Score

0.1086

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks3	A	G	16: 4,955,910	M174T	possibly damaging	Het
Arhgap23	G	A	11: 97,466,478	R934Q	possibly damaging	Het
B3galnt2	C	T	13: 13,980,480		probably null	Het
B430305J03Rik	T	C	3: 61,364,118	S69G	unknown	Het
C87499	T	C	4: 88,628,179	K309E	possibly damaging	Het
Cd163	A	T	6: 124,318,938	N747I	possibly damaging	Het
Cep126	A	G	9: 8,099,816	S906P	probably damaging	Het
Cyp4f39	G	A	17: 32,486,779	G318R	probably damaging	Het
D630003M21Rik	C	T	2: 158,217,209	G257D	probably damaging	Het
Dcaf10	T	C	4: 45,342,583	L139P	probably damaging	Het
Dcc	A	G	18: 71,378,824	V840A	probably benign	Het
Dnhd1	A	T	7: 105,703,967	I2776L	probably benign	Het
Fam166b	T	C	4: 43,428,022	D145G	possibly damaging	Het
Fbxo24	G	T	5: 137,621,261	F234L	probably damaging	Het
Gm21190	T	C	5: 15,527,904		probably null	Het
Grhl3	C	T	4: 135,546,246	R565Q	probably damaging	Het
Gtf3c1	A	T	7: 125,645,670	Y1731N	probably damaging	Het
Il1a	C	A	2: 129,304,773	R133S	probably benign	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Klc3	G	A	7: 19,394,889	T481M	probably benign	Het
Map2k6	A	T	11: 110,492,908	I127F		Het
Mapk8	A	T	14: 33,408,111	N63K	probably damaging	Het
Med13l	T	C	5: 118,742,760	W1306R	probably damaging	Het
Megf6	C	A	4: 154,267,315	Q1162K	probably benign	Het
Myo5b	A	G	18: 74,708,024	E992G	possibly damaging	Het
Ndst4	C	T	3: 125,714,659	T291M	probably benign	Het
Nek10	T	A	14: 14,955,503	F838L	probably benign	Het
Nrm	A	G	17: 35,864,584	H194R	probably damaging	Het
Nup188	T	C	2: 30,340,601	S1384P	probably benign	Het
Olfml2a	C	A	2: 38,960,127	D618E	probably damaging	Het
Olfr466	A	C	13: 65,152,743	N173T	possibly damaging	Het
Olfr506	C	T	7: 108,613,063	T252I	probably benign	Het
Olfr937	A	G	9: 39,060,579	L29P	probably damaging	Het
Olfr938	G	A	9: 39,078,334	S137F	probably damaging	Het
P2ry1	T	C	3: 61,003,674	F78S	possibly damaging	Het
Pcdhb18	T	C	18: 37,491,923	F769L	probably benign	Het
Poc5	A	G	13: 96,396,796	E144G	probably damaging	Het
Pole	T	A	5: 110,303,903	N870K	possibly damaging	Het
Polr2b	T	C	5: 77,349,119	F1159L	possibly damaging	Het
Rubcnl	A	G	14: 75,042,353	Y392C	probably benign	Het
Sec31a	T	C	5: 100,385,270	T539A	probably damaging	Het
Serpinh1	A	C	7: 99,346,356	S340A	probably damaging	Het
Slc1a5	T	A	7: 16,796,160		probably null	Het
Soat2	A	G	15: 102,162,578	D469G	probably benign	Het
Speg	T	C	1: 75,384,835	L70P	probably damaging	Het
Spred2	T	C	11: 19,924,958		probably null	Het
Stac2	A	C	11: 98,042,613	S168A	probably damaging	Het
Stx1a	T	A	5: 135,037,188	D31E	probably benign	Het
Timeless	C	T	10: 128,249,754	T885M	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tsen34	T	C	7: 3,695,615	Y253H	probably damaging	Het
Unc13b	T	C	4: 43,173,966	V1598A	unknown	Het
Zfat	A	T	15: 68,105,043	Y1086N	probably damaging	Het
Zfp551	G	A	7: 12,416,595	H296Y	probably benign	Het

Other mutations in Atad5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Atad5	APN	11	80132858	missense	probably benign	0.22
IGL00916:Atad5	APN	11	80119000	missense	probably damaging	1.00
IGL01348:Atad5	APN	11	80095564	missense	probably benign	0.00
IGL01601:Atad5	APN	11	80095517	missense	probably benign	0.45
IGL01916:Atad5	APN	11	80112839	critical splice donor site	probably null
IGL02028:Atad5	APN	11	80134110	missense	probably benign	0.20
IGL02095:Atad5	APN	11	80094707	missense	probably benign	0.24
IGL02142:Atad5	APN	11	80094197	missense	probably benign	0.00
IGL02206:Atad5	APN	11	80094183	missense	probably damaging	1.00
IGL02385:Atad5	APN	11	80094627	missense	probably benign	0.04
IGL02858:Atad5	APN	11	80089775	missense	probably damaging	1.00
IGL02962:Atad5	APN	11	80108579	missense	possibly damaging	0.86
PIT4362001:Atad5	UTSW	11	80111567	missense	probably benign	0.04
R0040:Atad5	UTSW	11	80098014	missense	probably benign
R0157:Atad5	UTSW	11	80089817	missense	possibly damaging	0.74
R0211:Atad5	UTSW	11	80095647	missense	probably benign	0.00
R0211:Atad5	UTSW	11	80095647	missense	probably benign	0.00
R0319:Atad5	UTSW	11	80120790	splice site	probably benign
R0401:Atad5	UTSW	11	80120699	missense	probably benign	0.11
R0426:Atad5	UTSW	11	80112832	missense	probably benign	0.14
R0452:Atad5	UTSW	11	80106421	missense	probably damaging	0.98
R0496:Atad5	UTSW	11	80100356	missense	probably benign	0.08
R1691:Atad5	UTSW	11	80095532	missense	probably benign	0.00
R1812:Atad5	UTSW	11	80133047	missense	probably damaging	0.98
R2070:Atad5	UTSW	11	80098052	splice site	probably null
R2071:Atad5	UTSW	11	80098052	splice site	probably null
R2153:Atad5	UTSW	11	80106377	missense	probably benign	0.04
R2415:Atad5	UTSW	11	80094251	missense	probably damaging	1.00
R3917:Atad5	UTSW	11	80103294	missense	probably null	0.97
R4025:Atad5	UTSW	11	80120686	missense	probably damaging	1.00
R4464:Atad5	UTSW	11	80100311	splice site	probably null
R4561:Atad5	UTSW	11	80095889	missense	probably benign	0.01
R4579:Atad5	UTSW	11	80095191	missense	probably damaging	1.00
R4844:Atad5	UTSW	11	80114311	splice site	probably null
R4853:Atad5	UTSW	11	80095272	missense	probably damaging	1.00
R4873:Atad5	UTSW	11	80120689	missense	probably damaging	1.00
R4875:Atad5	UTSW	11	80120689	missense	probably damaging	1.00
R5054:Atad5	UTSW	11	80094676	missense	probably benign	0.10
R5226:Atad5	UTSW	11	80095062	missense	probably damaging	0.99
R5397:Atad5	UTSW	11	80111493	missense	probably damaging	1.00
R5449:Atad5	UTSW	11	80124108	missense	probably damaging	1.00
R5571:Atad5	UTSW	11	80111556	missense	probably benign	0.05
R5575:Atad5	UTSW	11	80100323	missense	probably benign	0.02
R5857:Atad5	UTSW	11	80131329	missense	probably benign	0.06
R5927:Atad5	UTSW	11	80127285	missense	probably damaging	1.00
R5928:Atad5	UTSW	11	80094177	missense	probably damaging	1.00
R5949:Atad5	UTSW	11	80096009	nonsense	probably null
R6102:Atad5	UTSW	11	80111572	critical splice donor site	probably null
R6254:Atad5	UTSW	11	80127389	missense	probably damaging	0.96
R6562:Atad5	UTSW	11	80133206	missense	probably benign	0.26
R6744:Atad5	UTSW	11	80134032	missense	probably benign	0.00
R7092:Atad5	UTSW	11	80120720	missense	possibly damaging	0.68
R7202:Atad5	UTSW	11	80089775	missense	probably damaging	1.00
R7352:Atad5	UTSW	11	80103343	critical splice donor site	probably null
R7358:Atad5	UTSW	11	80133036	missense	probably benign	0.32
R7420:Atad5	UTSW	11	80095862	missense	probably benign	0.06
R7453:Atad5	UTSW	11	80119143	critical splice donor site	probably null
R7990:Atad5	UTSW	11	80133253	nonsense	probably null
R8012:Atad5	UTSW	11	80094240	missense	probably damaging	1.00
R8152:Atad5	UTSW	11	80095170	missense	possibly damaging	0.59
R8421:Atad5	UTSW	11	80094558	missense	probably damaging	0.98
R8842:Atad5	UTSW	11	80110084	missense	possibly damaging	0.87
R8918:Atad5	UTSW	11	80095647	missense	probably benign	0.02
R8943:Atad5	UTSW	11	80095698	missense	possibly damaging	0.86
R8944:Atad5	UTSW	11	80095698	missense	possibly damaging	0.86
R9134:Atad5	UTSW	11	80133105	missense	probably benign	0.00
R9137:Atad5	UTSW	11	80095655	missense	probably damaging	1.00
R9301:Atad5	UTSW	11	80096019	missense	probably damaging	1.00
R9372:Atad5	UTSW	11	80094268	missense	possibly damaging	0.68
R9404:Atad5	UTSW	11	80114238	missense	probably damaging	1.00
R9443:Atad5	UTSW	11	80132562	missense	probably benign	0.01
R9471:Atad5	UTSW	11	80132698	missense	possibly damaging	0.65
R9577:Atad5	UTSW	11	80114170	missense	probably damaging	1.00
R9656:Atad5	UTSW	11	80089716	start gained	probably benign
R9659:Atad5	UTSW	11	80089716	start gained	probably benign
R9661:Atad5	UTSW	11	80089716	start gained	probably benign
RF003:Atad5	UTSW	11	80111560	missense	probably damaging	0.99
X0024:Atad5	UTSW	11	80132783	missense	probably benign	0.02
Z1176:Atad5	UTSW	11	80094896	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTATGTCTCTACACGCCAAC -3'
(R):5'- TCAGTGGGTAGACAGACCAC -3'

Sequencing Primer
(F):5'- CCAATCAGGAGATCTCTGAGAAGTTG -3'
(R):5'- TTACCTAACCTATGAGGGCCAGTC -3'

Posted On

2019-09-13