Mutagenetix > Incidental Mutations

Incidental Mutation 'R7345:Map2k6'

570157

Institutional Source

Beutler Lab

Gene Symbol

Map2k6

Ensembl Gene

ENSMUSG00000020623

Gene Name

mitogen-activated protein kinase kinase 6

Synonyms

MAP kinase kinase 6, SAPKK3, Prkmk6, MKK6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110399122-110525522 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110492908 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 127 (I127F)

Ref Sequence

ENSEMBL: ENSMUSP00000020949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020949] [ENSMUST00000100260]

Predicted Effect

SMART Domains

Protein: ENSMUSP00000020949
Gene: ENSMUSG00000020623
AA Change: I127F

Domain	Start	End	E-Value	Type
S_TKc	53	314	2.82e-73	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000097831
Gene: ENSMUSG00000020623
AA Change: I127F

Domain	Start	End	E-Value	Type
Pfam:Pkinase	53	288	4.3e-47	PFAM
Pfam:Pkinase_Tyr	53	289	1.2e-32	PFAM
Pfam:Kinase-like	57	274	7.3e-8	PFAM

Meta Mutation Damage Score

0.2094

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dual specificity protein kinase family, which functions as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This protein phosphorylates and activates p38 MAP kinase in response to inflammatory cytokines or environmental stress. As an essential component of p38 MAP kinase mediated signal transduction pathway, this gene is involved in many cellular processes such as stress induced cell cycle arrest, transcription activation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null targeted mutations of this gene are viable, grow normally and have no gross physical or histologic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks3	A	G	16: 4,955,910	M174T	possibly damaging	Het
Arhgap23	G	A	11: 97,466,478	R934Q	possibly damaging	Het
Atad5	T	C	11: 80,096,006	S640P	probably damaging	Het
B3galnt2	C	T	13: 13,980,480		probably null	Het
B430305J03Rik	T	C	3: 61,364,118	S69G	unknown	Het
C87499	T	C	4: 88,628,179	K309E	possibly damaging	Het
Cd163	A	T	6: 124,318,938	N747I	possibly damaging	Het
Cep126	A	G	9: 8,099,816	S906P	probably damaging	Het
Cyp4f39	G	A	17: 32,486,779	G318R	probably damaging	Het
D630003M21Rik	C	T	2: 158,217,209	G257D	probably damaging	Het
Dcaf10	T	C	4: 45,342,583	L139P	probably damaging	Het
Dcc	A	G	18: 71,378,824	V840A	probably benign	Het
Dnhd1	A	T	7: 105,703,967	I2776L	probably benign	Het
Fam166b	T	C	4: 43,428,022	D145G	possibly damaging	Het
Fbxo24	G	T	5: 137,621,261	F234L	probably damaging	Het
Gm21190	T	C	5: 15,527,904		probably null	Het
Grhl3	C	T	4: 135,546,246	R565Q	probably damaging	Het
Gtf3c1	A	T	7: 125,645,670	Y1731N	probably damaging	Het
Il1a	C	A	2: 129,304,773	R133S	probably benign	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Klc3	G	A	7: 19,394,889	T481M	probably benign	Het
Mapk8	A	T	14: 33,408,111	N63K	probably damaging	Het
Med13l	T	C	5: 118,742,760	W1306R	probably damaging	Het
Megf6	C	A	4: 154,267,315	Q1162K	probably benign	Het
Myo5b	A	G	18: 74,708,024	E992G	possibly damaging	Het
Ndst4	C	T	3: 125,714,659	T291M	probably benign	Het
Nek10	T	A	14: 14,955,503	F838L	probably benign	Het
Nrm	A	G	17: 35,864,584	H194R	probably damaging	Het
Nup188	T	C	2: 30,340,601	S1384P	probably benign	Het
Olfml2a	C	A	2: 38,960,127	D618E	probably damaging	Het
Olfr466	A	C	13: 65,152,743	N173T	possibly damaging	Het
Olfr506	C	T	7: 108,613,063	T252I	probably benign	Het
Olfr937	A	G	9: 39,060,579	L29P	probably damaging	Het
Olfr938	G	A	9: 39,078,334	S137F	probably damaging	Het
P2ry1	T	C	3: 61,003,674	F78S	possibly damaging	Het
Pcdhb18	T	C	18: 37,491,923	F769L	probably benign	Het
Poc5	A	G	13: 96,396,796	E144G	probably damaging	Het
Pole	T	A	5: 110,303,903	N870K	possibly damaging	Het
Polr2b	T	C	5: 77,349,119	F1159L	possibly damaging	Het
Rubcnl	A	G	14: 75,042,353	Y392C	probably benign	Het
Sec31a	T	C	5: 100,385,270	T539A	probably damaging	Het
Serpinh1	A	C	7: 99,346,356	S340A	probably damaging	Het
Slc1a5	T	A	7: 16,796,160		probably null	Het
Soat2	A	G	15: 102,162,578	D469G	probably benign	Het
Speg	T	C	1: 75,384,835	L70P	probably damaging	Het
Spred2	T	C	11: 19,924,958		probably null	Het
Stac2	A	C	11: 98,042,613	S168A	probably damaging	Het
Stx1a	T	A	5: 135,037,188	D31E	probably benign	Het
Timeless	C	T	10: 128,249,754	T885M	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tsen34	T	C	7: 3,695,615	Y253H	probably damaging	Het
Unc13b	T	C	4: 43,173,966	V1598A	unknown	Het
Zfat	A	T	15: 68,105,043	Y1086N	probably damaging	Het
Zfp551	G	A	7: 12,416,595	H296Y	probably benign	Het

Other mutations in Map2k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01336:Map2k6	APN	11	110496411	missense	probably damaging	1.00
IGL01778:Map2k6	APN	11	110512869	intron	probably benign
IGL02058:Map2k6	APN	11	110492583	missense	probably damaging	1.00
IGL02580:Map2k6	APN	11	110490841	missense	probably damaging	0.98
IGL03139:Map2k6	APN	11	110496473	splice site	probably benign
Heartening	UTSW	11	110492908	missense
Uplifting	UTSW	11	110492562	missense	probably damaging	1.00
R0230:Map2k6	UTSW	11	110496455	missense	probably damaging	1.00
R0361:Map2k6	UTSW	11	110499509	missense	probably damaging	0.99
R0634:Map2k6	UTSW	11	110494343	nonsense	probably null
R1716:Map2k6	UTSW	11	110497901	missense	probably damaging	1.00
R2214:Map2k6	UTSW	11	110496341	missense	probably damaging	1.00
R2279:Map2k6	UTSW	11	110499464	missense	probably damaging	1.00
R4610:Map2k6	UTSW	11	110499474	missense	probably damaging	1.00
R4677:Map2k6	UTSW	11	110399394	utr 5 prime	probably benign
R5299:Map2k6	UTSW	11	110492963	missense	probably benign	0.03
R5761:Map2k6	UTSW	11	110399371	utr 5 prime	probably benign
R5996:Map2k6	UTSW	11	110497906	missense	possibly damaging	0.77
R6391:Map2k6	UTSW	11	110490877	critical splice donor site	probably null
R6529:Map2k6	UTSW	11	110492562	missense	probably damaging	1.00
R7020:Map2k6	UTSW	11	110506714	intron	probably benign
R7681:Map2k6	UTSW	11	110497903	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAAGAGCCTCTGGTCGCATAG -3'
(R):5'- AGACACGAAGCCTGGACTTC -3'

Sequencing Primer
(F):5'- GGTCGCATAGCCTCACTAC -3'
(R):5'- CTCCCATTCTCCTTAAGTAGGTGG -3'

Posted On

2019-09-13