Incidental Mutation 'R7345:Tmem94'
ID570158
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Nametransmembrane protein 94
Synonyms2310067B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115765433-115799366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115786256 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 118 (R118L)
Ref Sequence ENSEMBL: ENSMUSP00000091440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000103034] [ENSMUST00000125918] [ENSMUST00000136720] [ENSMUST00000141871]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093912
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103033
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103034
AA Change: R74L
SMART Domains Protein: ENSMUSP00000099323
Gene: ENSMUSG00000020747
AA Change: R74L

DomainStartEndE-ValueType
transmembrane domain 52 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125918
SMART Domains Protein: ENSMUSP00000116666
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 105 115 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136720
SMART Domains Protein: ENSMUSP00000122111
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141871
SMART Domains Protein: ENSMUSP00000118396
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Meta Mutation Damage Score 0.3043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115795328 missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115790284 missense probably benign 0.25
IGL01314:Tmem94 APN 11 115790009 missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115787538 missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115797432 missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115793071 missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115796401 nonsense probably null
IGL02816:Tmem94 APN 11 115788704 splice site probably null
IGL02836:Tmem94 APN 11 115792939 missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115792421 missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115792398 missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115792068 unclassified probably benign
IGL03397:Tmem94 APN 11 115787568 unclassified probably benign
capitulate UTSW 11 115796746 missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115796724 unclassified probably benign
R0336:Tmem94 UTSW 11 115787385 missense probably benign
R0370:Tmem94 UTSW 11 115788717 missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115794781 splice site probably null
R0638:Tmem94 UTSW 11 115792060 splice site probably null
R0647:Tmem94 UTSW 11 115796795 missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115791978 missense probably benign 0.00
R1469:Tmem94 UTSW 11 115795091 unclassified probably benign
R1616:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R1621:Tmem94 UTSW 11 115785845 missense probably benign
R1682:Tmem94 UTSW 11 115790230 missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115794748 missense probably damaging 1.00
R1760:Tmem94 UTSW 11 115796754 missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115793213 nonsense probably null
R1926:Tmem94 UTSW 11 115792900 missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115788674 missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115794328 missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115794749 missense probably benign
R2419:Tmem94 UTSW 11 115796815 missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115791961 missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115789254 missense probably benign 0.00
R4708:Tmem94 UTSW 11 115786295 missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115796112 nonsense probably null
R5026:Tmem94 UTSW 11 115793104 missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115793190 missense probably benign 0.04
R5716:Tmem94 UTSW 11 115792428 missense probably benign 0.17
R6180:Tmem94 UTSW 11 115791031 critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115796746 missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115798286 missense probably damaging 1.00
R6696:Tmem94 UTSW 11 115791988 missense probably damaging 1.00
R6883:Tmem94 UTSW 11 115796461 missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115785830 missense possibly damaging 0.47
R7060:Tmem94 UTSW 11 115792938 missense probably damaging 1.00
R7171:Tmem94 UTSW 11 115790955 splice site probably null
R7181:Tmem94 UTSW 11 115794774 missense probably damaging 0.97
R7290:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7292:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7346:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7378:Tmem94 UTSW 11 115794174 missense probably damaging 1.00
R7380:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R7460:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7461:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7463:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7464:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7465:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7673:Tmem94 UTSW 11 115788378 missense probably benign 0.05
R7995:Tmem94 UTSW 11 115797971 missense probably damaging 1.00
R8094:Tmem94 UTSW 11 115788392 critical splice donor site probably null
RF003:Tmem94 UTSW 11 115796132 missense probably damaging 1.00
X0024:Tmem94 UTSW 11 115786253 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCTGAGGAGCTGTAGTGACC -3'
(R):5'- CCAGTACCAGTGGACAAGAC -3'

Sequencing Primer
(F):5'- CTGTAGTGACCCGAGCATAG -3'
(R):5'- GGGGGTAAAAACTCTCAACTTCC -3'
Posted On2019-09-13