Incidental Mutation 'R7345:Tmem94'
ID 570158
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Name transmembrane protein 94
Synonyms 2310067B10Rik
MMRRC Submission 045379-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.276) question?
Stock # R7345 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 115656245-115689859 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 115677082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 118 (R118L)
Ref Sequence ENSEMBL: ENSMUSP00000091440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000103034] [ENSMUST00000125918] [ENSMUST00000136720] [ENSMUST00000141871]
AlphaFold Q7TSH8
Predicted Effect possibly damaging
Transcript: ENSMUST00000093912
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103033
AA Change: R118L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: R118L

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000103034
AA Change: R74L
SMART Domains Protein: ENSMUSP00000099323
Gene: ENSMUSG00000020747
AA Change: R74L

DomainStartEndE-ValueType
transmembrane domain 52 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125918
SMART Domains Protein: ENSMUSP00000116666
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 105 115 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136720
SMART Domains Protein: ENSMUSP00000122111
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141871
SMART Domains Protein: ENSMUSP00000118396
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
low complexity region 72 84 N/A INTRINSIC
Meta Mutation Damage Score 0.3043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,773,774 (GRCm39) M174T possibly damaging Het
Arhgap23 G A 11: 97,357,304 (GRCm39) R934Q possibly damaging Het
Atad5 T C 11: 79,986,832 (GRCm39) S640P probably damaging Het
B3galnt2 C T 13: 14,155,065 (GRCm39) probably null Het
B430305J03Rik T C 3: 61,271,539 (GRCm39) S69G unknown Het
Cd163 A T 6: 124,295,897 (GRCm39) N747I possibly damaging Het
Cep126 A G 9: 8,099,817 (GRCm39) S906P probably damaging Het
Cimip2b T C 4: 43,428,022 (GRCm39) D145G possibly damaging Het
Cyp4f39 G A 17: 32,705,753 (GRCm39) G318R probably damaging Het
D630003M21Rik C T 2: 158,059,129 (GRCm39) G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 (GRCm39) L139P probably damaging Het
Dcc A G 18: 71,511,895 (GRCm39) V840A probably benign Het
Dnhd1 A T 7: 105,353,174 (GRCm39) I2776L probably benign Het
Fbxo24 G T 5: 137,619,523 (GRCm39) F234L probably damaging Het
Gm21190 T C 5: 15,732,902 (GRCm39) probably null Het
Grhl3 C T 4: 135,273,557 (GRCm39) R565Q probably damaging Het
Gtf3c1 A T 7: 125,244,842 (GRCm39) Y1731N probably damaging Het
Il1a C A 2: 129,146,693 (GRCm39) R133S probably benign Het
Ipo4 C T 14: 55,872,988 (GRCm39) R23Q probably benign Het
Klc3 G A 7: 19,128,814 (GRCm39) T481M probably benign Het
Map2k6 A T 11: 110,383,734 (GRCm39) I127F Het
Mapk8 A T 14: 33,130,068 (GRCm39) N63K probably damaging Het
Med13l T C 5: 118,880,825 (GRCm39) W1306R probably damaging Het
Megf6 C A 4: 154,351,772 (GRCm39) Q1162K probably benign Het
Myo5b A G 18: 74,841,095 (GRCm39) E992G possibly damaging Het
Ndst4 C T 3: 125,508,308 (GRCm39) T291M probably benign Het
Nek10 T A 14: 14,955,503 (GRCm38) F838L probably benign Het
Nrm A G 17: 36,175,476 (GRCm39) H194R probably damaging Het
Nup188 T C 2: 30,230,613 (GRCm39) S1384P probably benign Het
Olfml2a C A 2: 38,850,139 (GRCm39) D618E probably damaging Het
Or5p78 C T 7: 108,212,270 (GRCm39) T252I probably benign Het
Or8g23 A G 9: 38,971,875 (GRCm39) L29P probably damaging Het
Or8g24 G A 9: 38,989,630 (GRCm39) S137F probably damaging Het
Or9s18 A C 13: 65,300,557 (GRCm39) N173T possibly damaging Het
P2ry1 T C 3: 60,911,095 (GRCm39) F78S possibly damaging Het
Pcdhb18 T C 18: 37,624,976 (GRCm39) F769L probably benign Het
Poc5 A G 13: 96,533,304 (GRCm39) E144G probably damaging Het
Pole T A 5: 110,451,769 (GRCm39) N870K possibly damaging Het
Polr2b T C 5: 77,496,966 (GRCm39) F1159L possibly damaging Het
Pramel32 T C 4: 88,546,416 (GRCm39) K309E possibly damaging Het
Rubcnl A G 14: 75,279,793 (GRCm39) Y392C probably benign Het
Sec31a T C 5: 100,533,129 (GRCm39) T539A probably damaging Het
Serpinh1 A C 7: 98,995,563 (GRCm39) S340A probably damaging Het
Slc1a5 T A 7: 16,530,085 (GRCm39) probably null Het
Soat2 A G 15: 102,071,013 (GRCm39) D469G probably benign Het
Speg T C 1: 75,361,479 (GRCm39) L70P probably damaging Het
Spred2 T C 11: 19,874,958 (GRCm39) probably null Het
Stac2 A C 11: 97,933,439 (GRCm39) S168A probably damaging Het
Stx1a T A 5: 135,066,042 (GRCm39) D31E probably benign Het
Timeless C T 10: 128,085,623 (GRCm39) T885M probably damaging Het
Tsen34 T C 7: 3,698,614 (GRCm39) Y253H probably damaging Het
Unc13b T C 4: 43,173,966 (GRCm39) V1598A unknown Het
Zfat A T 15: 67,976,892 (GRCm39) Y1086N probably damaging Het
Zfp551 G A 7: 12,150,522 (GRCm39) H296Y probably benign Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115,686,154 (GRCm39) missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115,681,110 (GRCm39) missense probably benign 0.25
IGL01314:Tmem94 APN 11 115,680,835 (GRCm39) missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115,678,364 (GRCm39) missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115,685,571 (GRCm39) missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115,685,571 (GRCm39) missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115,688,258 (GRCm39) missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115,683,897 (GRCm39) missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115,687,227 (GRCm39) nonsense probably null
IGL02816:Tmem94 APN 11 115,679,530 (GRCm39) splice site probably null
IGL02836:Tmem94 APN 11 115,683,765 (GRCm39) missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115,683,247 (GRCm39) missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115,683,224 (GRCm39) missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115,682,894 (GRCm39) unclassified probably benign
IGL03397:Tmem94 APN 11 115,678,394 (GRCm39) unclassified probably benign
capitulate UTSW 11 115,687,572 (GRCm39) missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115,687,550 (GRCm39) unclassified probably benign
R0336:Tmem94 UTSW 11 115,678,211 (GRCm39) missense probably benign
R0370:Tmem94 UTSW 11 115,679,543 (GRCm39) missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115,685,607 (GRCm39) splice site probably null
R0638:Tmem94 UTSW 11 115,682,886 (GRCm39) splice site probably null
R0647:Tmem94 UTSW 11 115,687,621 (GRCm39) missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115,682,804 (GRCm39) missense probably benign 0.00
R1469:Tmem94 UTSW 11 115,685,917 (GRCm39) unclassified probably benign
R1616:Tmem94 UTSW 11 115,686,971 (GRCm39) critical splice donor site probably null
R1621:Tmem94 UTSW 11 115,676,671 (GRCm39) missense probably benign
R1682:Tmem94 UTSW 11 115,681,056 (GRCm39) missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115,685,574 (GRCm39) missense probably damaging 1.00
R1760:Tmem94 UTSW 11 115,687,580 (GRCm39) missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115,684,039 (GRCm39) nonsense probably null
R1926:Tmem94 UTSW 11 115,683,726 (GRCm39) missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115,679,500 (GRCm39) missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115,685,154 (GRCm39) missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115,685,575 (GRCm39) missense probably benign
R2419:Tmem94 UTSW 11 115,687,641 (GRCm39) missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115,682,787 (GRCm39) missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115,680,080 (GRCm39) missense probably benign 0.00
R4708:Tmem94 UTSW 11 115,677,121 (GRCm39) missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115,686,938 (GRCm39) nonsense probably null
R5026:Tmem94 UTSW 11 115,683,930 (GRCm39) missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115,684,016 (GRCm39) missense probably benign 0.04
R5716:Tmem94 UTSW 11 115,683,254 (GRCm39) missense probably benign 0.17
R6180:Tmem94 UTSW 11 115,681,857 (GRCm39) critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115,687,572 (GRCm39) missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115,689,112 (GRCm39) missense probably damaging 1.00
R6696:Tmem94 UTSW 11 115,682,814 (GRCm39) missense probably damaging 1.00
R6883:Tmem94 UTSW 11 115,687,287 (GRCm39) missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115,676,656 (GRCm39) missense possibly damaging 0.47
R7060:Tmem94 UTSW 11 115,683,764 (GRCm39) missense probably damaging 1.00
R7171:Tmem94 UTSW 11 115,681,781 (GRCm39) splice site probably null
R7181:Tmem94 UTSW 11 115,685,600 (GRCm39) missense probably damaging 0.97
R7290:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7292:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7346:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7378:Tmem94 UTSW 11 115,685,000 (GRCm39) missense probably damaging 1.00
R7380:Tmem94 UTSW 11 115,686,971 (GRCm39) critical splice donor site probably null
R7460:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7461:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7463:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7464:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7465:Tmem94 UTSW 11 115,677,082 (GRCm39) missense possibly damaging 0.54
R7673:Tmem94 UTSW 11 115,679,204 (GRCm39) missense probably benign 0.05
R7995:Tmem94 UTSW 11 115,688,797 (GRCm39) missense probably damaging 1.00
R8094:Tmem94 UTSW 11 115,679,218 (GRCm39) critical splice donor site probably null
R8447:Tmem94 UTSW 11 115,688,696 (GRCm39) missense probably benign
R8447:Tmem94 UTSW 11 115,688,023 (GRCm39) missense possibly damaging 0.93
R8825:Tmem94 UTSW 11 115,688,201 (GRCm39) missense probably benign 0.00
R8910:Tmem94 UTSW 11 115,688,252 (GRCm39) missense probably damaging 1.00
R9226:Tmem94 UTSW 11 115,683,191 (GRCm39) missense probably damaging 1.00
RF003:Tmem94 UTSW 11 115,686,958 (GRCm39) missense probably damaging 1.00
X0024:Tmem94 UTSW 11 115,677,079 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TCTGAGGAGCTGTAGTGACC -3'
(R):5'- CCAGTACCAGTGGACAAGAC -3'

Sequencing Primer
(F):5'- CTGTAGTGACCCGAGCATAG -3'
(R):5'- GGGGGTAAAAACTCTCAACTTCC -3'
Posted On 2019-09-13