Incidental Mutation 'R7345:Olfr466'
ID570159
Institutional Source Beutler Lab
Gene Symbol Olfr466
Ensembl Gene ENSMUSG00000049806
Gene Nameolfactory receptor 466
SynonymsGA_x6K02T2PB7A-3051266-3052192, MOR209-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location65150240-65156152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65152743 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 173 (N173T)
Ref Sequence ENSEMBL: ENSMUSP00000149328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058907] [ENSMUST00000214214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058907
AA Change: N173T

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062692
Gene: ENSMUSG00000049806
AA Change: N173T

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.8e-47 PFAM
Pfam:7tm_1 39 288 3.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214214
AA Change: N173T

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Olfr466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Olfr466 APN 13 65152396 missense probably damaging 0.99
R0269:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0617:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0646:Olfr466 UTSW 13 65153063 missense probably damaging 1.00
R1338:Olfr466 UTSW 13 65152383 missense probably damaging 1.00
R1893:Olfr466 UTSW 13 65152992 missense possibly damaging 0.92
R3108:Olfr466 UTSW 13 65153061 missense possibly damaging 0.89
R4408:Olfr466 UTSW 13 65152700 missense probably benign 0.00
R4625:Olfr466 UTSW 13 65152860 missense possibly damaging 0.95
R4732:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4733:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4849:Olfr466 UTSW 13 65152679 missense possibly damaging 0.96
R5058:Olfr466 UTSW 13 65152929 missense possibly damaging 0.96
R5419:Olfr466 UTSW 13 65152774 missense probably damaging 1.00
R5569:Olfr466 UTSW 13 65152979 missense possibly damaging 0.81
R5662:Olfr466 UTSW 13 65152253 missense possibly damaging 0.76
R7292:Olfr466 UTSW 13 65152842 missense possibly damaging 0.94
R7427:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R7428:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R8162:Olfr466 UTSW 13 65152920 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGAAGCATTTCTCCTGGCTG -3'
(R):5'- CAATCAAGTGGGAGGCACAC -3'

Sequencing Primer
(F):5'- TGCCATGGCCTATGACCG -3'
(R):5'- CACACGTGGAGAAAGCTTTC -3'
Posted On2019-09-13