Incidental Mutation 'R7345:Mapk8'
ID570162
Institutional Source Beutler Lab
Gene Symbol Mapk8
Ensembl Gene ENSMUSG00000021936
Gene Namemitogen-activated protein kinase 8
SynonymsJNK1, c-Jun N-terminal kinase, Prkm8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33377898-33447158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33408111 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 63 (N63K)
Ref Sequence ENSEMBL: ENSMUSP00000022504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022504] [ENSMUST00000111942] [ENSMUST00000111943] [ENSMUST00000111944] [ENSMUST00000111945] [ENSMUST00000226798]
Predicted Effect probably damaging
Transcript: ENSMUST00000022504
AA Change: N63K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022504
Gene: ENSMUSG00000021936
AA Change: N63K

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111942
AA Change: N63K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107573
Gene: ENSMUSG00000021936
AA Change: N63K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 208 1.8e-25 PFAM
Pfam:Pkinase 26 210 5.2e-48 PFAM
Pfam:Kdo 33 178 6.4e-9 PFAM
SCOP:d1pme__ 216 286 2e-17 SMART
PDB:3GP0|A 218 288 4e-11 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000111943
AA Change: N63K

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107574
Gene: ENSMUSG00000021936
AA Change: N63K

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111944
AA Change: N63K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107575
Gene: ENSMUSG00000021936
AA Change: N63K

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111945
AA Change: N63K

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107576
Gene: ENSMUSG00000021936
AA Change: N63K

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226798
Meta Mutation Damage Score 0.5226 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal T cell differentiation and proliferation, cardiac morphology and physiology, and chemically-induced tumorigenesis. Mice homozygous for another knock-out allele exhibit abnormal glucose homeostasis and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Mapk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Mapk8 APN 14 33383900 missense probably benign 0.01
R0255:Mapk8 UTSW 14 33387307 splice site probably benign
R0401:Mapk8 UTSW 14 33382208 missense probably benign 0.37
R0862:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R0864:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R1084:Mapk8 UTSW 14 33388803 nonsense probably null
R1637:Mapk8 UTSW 14 33410962 missense probably benign 0.00
R2038:Mapk8 UTSW 14 33388936 nonsense probably null
R3959:Mapk8 UTSW 14 33382253 missense probably null 0.21
R4087:Mapk8 UTSW 14 33390248 missense probably benign 0.00
R4181:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4183:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4184:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R5366:Mapk8 UTSW 14 33390729 missense probably damaging 1.00
R6076:Mapk8 UTSW 14 33390293 missense probably damaging 1.00
R6991:Mapk8 UTSW 14 33410884 missense possibly damaging 0.82
R7814:Mapk8 UTSW 14 33410877 nonsense probably null
R8194:Mapk8 UTSW 14 33382284 missense probably benign
Z1176:Mapk8 UTSW 14 33410886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTGCTACTACTTAATAACGGGG -3'
(R):5'- TGCCCACATACACTCAGTGG -3'

Sequencing Primer
(F):5'- CTACTACTTAATAACGGGGGTGGAG -3'
(R):5'- CACATACACTCAGTGGATCTTGGG -3'
Posted On2019-09-13