Incidental Mutation 'R7345:Soat2'
ID570166
Institutional Source Beutler Lab
Gene Symbol Soat2
Ensembl Gene ENSMUSG00000023045
Gene Namesterol O-acyltransferase 2
SynonymsACAT2, D15Wsu97e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102150526-102163469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102162578 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 469 (D469G)
Ref Sequence ENSEMBL: ENSMUSP00000023806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023806]
Predicted Effect probably benign
Transcript: ENSMUST00000023806
AA Change: D469G

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023806
Gene: ENSMUSG00000023045
AA Change: D469G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
Pfam:MBOAT 147 497 3.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160465
SMART Domains Protein: ENSMUSP00000124628
Gene: ENSMUSG00000023045

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene is a member of a small family of acyl coenzyme A:cholesterol acyltransferases. The gene encodes a membrane-bound enzyme localized in the endoplasmic reticulum that produces intracellular cholesterol esters from long-chain fatty acyl CoA and cholesterol. The cholesterol esters are then stored as cytoplasmic lipid droplets inside the cell. The enzyme is implicated in cholesterol absorption in the intestine and in the assembly and secretion of apolipoprotein B-containing lipoproteins such as very low density lipoprotein (VLDL). Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals exhibit elevated serum triglyceride levels and are resistant to fatty liver, hyperlipidemia, and gallstone development when fed a high fat, high cholesterol diet. When fed a Western diet homozygous mutant animals exhibit elevated HDL levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Pcdhb18 T C 18: 37,491,923 F769L probably benign Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Soat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Soat2 APN 15 102162115 missense probably damaging 0.96
IGL03093:Soat2 APN 15 102157643 missense probably damaging 1.00
R0091:Soat2 UTSW 15 102158139 missense probably damaging 1.00
R0391:Soat2 UTSW 15 102158753 missense possibly damaging 0.92
R0396:Soat2 UTSW 15 102150707 unclassified probably benign
R1078:Soat2 UTSW 15 102153138 splice site probably null
R3421:Soat2 UTSW 15 102156809 splice site probably benign
R3422:Soat2 UTSW 15 102156809 splice site probably benign
R3754:Soat2 UTSW 15 102157078 missense probably damaging 1.00
R4062:Soat2 UTSW 15 102161091 missense possibly damaging 0.85
R4623:Soat2 UTSW 15 102157709 intron probably benign
R5004:Soat2 UTSW 15 102161111 missense probably damaging 1.00
R5808:Soat2 UTSW 15 102154025 splice site probably null
R6481:Soat2 UTSW 15 102162055 missense probably damaging 1.00
R6595:Soat2 UTSW 15 102160593 missense probably damaging 0.98
R6876:Soat2 UTSW 15 102160614 missense probably damaging 1.00
R7429:Soat2 UTSW 15 102154300 missense probably damaging 1.00
R7572:Soat2 UTSW 15 102154021 critical splice donor site probably null
R7653:Soat2 UTSW 15 102162578 missense probably damaging 1.00
R7867:Soat2 UTSW 15 102151163 critical splice donor site probably null
R7910:Soat2 UTSW 15 102160671 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTTCCTGAGACCTTTAGG -3'
(R):5'- CATACCCTGTCCCTGACCATAG -3'

Sequencing Primer
(F):5'- AGACCTTTAGGAGTTTCTGCAGC -3'
(R):5'- GTCCCTGACCATAGCTATTGAATAG -3'
Posted On2019-09-13