Incidental Mutation 'R7345:Pcdhb18'
ID570170
Institutional Source Beutler Lab
Gene Symbol Pcdhb18
Ensembl Gene ENSMUSG00000048347
Gene Nameprotocadherin beta 18
SynonymsPcdhbR, Pcdhb9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7345 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37489465-37494505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37491923 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 769 (F769L)
Ref Sequence ENSEMBL: ENSMUSP00000052113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055949
AA Change: F769L

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347
AA Change: F769L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks3 A G 16: 4,955,910 M174T possibly damaging Het
Arhgap23 G A 11: 97,466,478 R934Q possibly damaging Het
Atad5 T C 11: 80,096,006 S640P probably damaging Het
B3galnt2 C T 13: 13,980,480 probably null Het
B430305J03Rik T C 3: 61,364,118 S69G unknown Het
C87499 T C 4: 88,628,179 K309E possibly damaging Het
Cd163 A T 6: 124,318,938 N747I possibly damaging Het
Cep126 A G 9: 8,099,816 S906P probably damaging Het
Cyp4f39 G A 17: 32,486,779 G318R probably damaging Het
D630003M21Rik C T 2: 158,217,209 G257D probably damaging Het
Dcaf10 T C 4: 45,342,583 L139P probably damaging Het
Dcc A G 18: 71,378,824 V840A probably benign Het
Dnhd1 A T 7: 105,703,967 I2776L probably benign Het
Fam166b T C 4: 43,428,022 D145G possibly damaging Het
Fbxo24 G T 5: 137,621,261 F234L probably damaging Het
Gm21190 T C 5: 15,527,904 probably null Het
Grhl3 C T 4: 135,546,246 R565Q probably damaging Het
Gtf3c1 A T 7: 125,645,670 Y1731N probably damaging Het
Il1a C A 2: 129,304,773 R133S probably benign Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Klc3 G A 7: 19,394,889 T481M probably benign Het
Map2k6 A T 11: 110,492,908 I127F Het
Mapk8 A T 14: 33,408,111 N63K probably damaging Het
Med13l T C 5: 118,742,760 W1306R probably damaging Het
Megf6 C A 4: 154,267,315 Q1162K probably benign Het
Myo5b A G 18: 74,708,024 E992G possibly damaging Het
Ndst4 C T 3: 125,714,659 T291M probably benign Het
Nek10 T A 14: 14,955,503 F838L probably benign Het
Nrm A G 17: 35,864,584 H194R probably damaging Het
Nup188 T C 2: 30,340,601 S1384P probably benign Het
Olfml2a C A 2: 38,960,127 D618E probably damaging Het
Olfr466 A C 13: 65,152,743 N173T possibly damaging Het
Olfr506 C T 7: 108,613,063 T252I probably benign Het
Olfr937 A G 9: 39,060,579 L29P probably damaging Het
Olfr938 G A 9: 39,078,334 S137F probably damaging Het
P2ry1 T C 3: 61,003,674 F78S possibly damaging Het
Poc5 A G 13: 96,396,796 E144G probably damaging Het
Pole T A 5: 110,303,903 N870K possibly damaging Het
Polr2b T C 5: 77,349,119 F1159L possibly damaging Het
Rubcnl A G 14: 75,042,353 Y392C probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Serpinh1 A C 7: 99,346,356 S340A probably damaging Het
Slc1a5 T A 7: 16,796,160 probably null Het
Soat2 A G 15: 102,162,578 D469G probably benign Het
Speg T C 1: 75,384,835 L70P probably damaging Het
Spred2 T C 11: 19,924,958 probably null Het
Stac2 A C 11: 98,042,613 S168A probably damaging Het
Stx1a T A 5: 135,037,188 D31E probably benign Het
Timeless C T 10: 128,249,754 T885M probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tsen34 T C 7: 3,695,615 Y253H probably damaging Het
Unc13b T C 4: 43,173,966 V1598A unknown Het
Zfat A T 15: 68,105,043 Y1086N probably damaging Het
Zfp551 G A 7: 12,416,595 H296Y probably benign Het
Other mutations in Pcdhb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Pcdhb18 APN 18 37491931 missense probably benign 0.35
IGL02651:Pcdhb18 APN 18 37491181 nonsense probably null
IGL02721:Pcdhb18 APN 18 37490031 missense probably benign 0.33
IGL02945:Pcdhb18 APN 18 37489995 missense probably benign 0.34
IGL03030:Pcdhb18 APN 18 37490733 missense probably damaging 1.00
IGL03346:Pcdhb18 APN 18 37489621 start codon destroyed probably null 0.99
R0206:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0208:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0680:Pcdhb18 UTSW 18 37490294 missense probably damaging 0.98
R1517:Pcdhb18 UTSW 18 37489620 start codon destroyed probably null 1.00
R1519:Pcdhb18 UTSW 18 37490892 missense probably damaging 1.00
R1597:Pcdhb18 UTSW 18 37491767 missense probably benign 0.19
R1735:Pcdhb18 UTSW 18 37490769 missense probably benign 0.00
R2089:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2206:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R2207:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R4773:Pcdhb18 UTSW 18 37490454 missense probably damaging 1.00
R4837:Pcdhb18 UTSW 18 37489814 missense probably damaging 1.00
R5271:Pcdhb18 UTSW 18 37491596 missense possibly damaging 0.94
R5568:Pcdhb18 UTSW 18 37491800 missense probably benign 0.44
R5647:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5648:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5690:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5692:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5812:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5813:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5928:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5929:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5930:Pcdhb18 UTSW 18 37491935 missense possibly damaging 0.63
R6209:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6255:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6602:Pcdhb18 UTSW 18 37490480 missense probably damaging 0.99
R6699:Pcdhb18 UTSW 18 37491952 missense probably benign 0.00
R7055:Pcdhb18 UTSW 18 37490811 missense possibly damaging 0.64
R7197:Pcdhb18 UTSW 18 37490383 missense probably benign 0.06
R7289:Pcdhb18 UTSW 18 37490647 missense probably damaging 1.00
R7403:Pcdhb18 UTSW 18 37491897 missense probably benign 0.09
R7541:Pcdhb18 UTSW 18 37491609 missense probably damaging 1.00
R7651:Pcdhb18 UTSW 18 37490993 missense probably benign 0.00
R7670:Pcdhb18 UTSW 18 37491696 missense probably damaging 1.00
R7673:Pcdhb18 UTSW 18 37491737 missense probably benign 0.39
R7783:Pcdhb18 UTSW 18 37489821 missense probably benign 0.01
R7819:Pcdhb18 UTSW 18 37491255 missense possibly damaging 0.60
R7826:Pcdhb18 UTSW 18 37490942 missense probably damaging 0.98
R7857:Pcdhb18 UTSW 18 37491311 missense probably benign
R7866:Pcdhb18 UTSW 18 37490459 missense probably damaging 0.99
R7895:Pcdhb18 UTSW 18 37490467 missense probably benign 0.27
X0022:Pcdhb18 UTSW 18 37490273 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATAGCCTTGGCATCTGTGTC -3'
(R):5'- CCTACTTGGAAGTTGAAAACGAAG -3'

Sequencing Primer
(F):5'- ATAGCCTTGGCATCTGTGTCTTCTC -3'
(R):5'- ACGAAGTTAGTTTTGCTGTGTAGC -3'
Posted On2019-09-13