Mutagenetix > Incidental Mutation

Incidental Mutation 'R7346:Tgfb2'

570178

Institutional Source

Beutler Lab

Gene Symbol

Tgfb2

Ensembl Gene

ENSMUSG00000039239

Gene Name

transforming growth factor, beta 2

Synonyms

Tgfb-2, Tgf-beta2

MMRRC Submission

045373-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7346 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

186354989-186438186 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 186382077 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 150 (F150S)

Ref Sequence

ENSEMBL: ENSMUSP00000142149 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045288] [ENSMUST00000195201]

AlphaFold

P27090

Predicted Effect

probably benign
Transcript: ENSMUST00000045288
AA Change: F122S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000043849
Gene: ENSMUSG00000039239
AA Change: F122S

Domain	Start	End	E-Value	Type
Pfam:TGFb_propeptide	20	284	1.1e-38	PFAM
TGFB	317	414	1.25e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195201
AA Change: F150S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000142149
Gene: ENSMUSG00000039239
AA Change: F150S

Domain	Start	End	E-Value	Type
Pfam:TGFb_propeptide	9	138	2.4e-9	PFAM
Pfam:TGFb_propeptide	152	311	1.4e-23	PFAM
TGFB	345	442	6.1e-40	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.1%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Mice lacking a functional copy of this gene display developmental defects in multiple organs and perinatal lethality. Heterozygous mutant mice exhibit aortic root aneurysm. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lungs, skull, limbs, spinal column, eyes, inner ears, and urogenital system, and perinatal mortality. Heterozygotes show abnormalities of the Cowpers' gland and intestinal mucosa. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	G	A	9: 55,914,587 (GRCm39)	P52S	unknown	Het
Adarb2	A	G	13: 8,620,420 (GRCm39)	E302G	probably damaging	Het
Adgrf5	T	A	17: 43,762,070 (GRCm39)	L1255H	probably damaging	Het
Adra1a	T	A	14: 66,875,733 (GRCm39)	I236N	probably benign	Het
As3mt	T	C	19: 46,708,891 (GRCm39)	F295S	probably damaging	Het
Bmp5	G	A	9: 75,780,642 (GRCm39)	R313Q	probably damaging	Het
Ccnj	T	A	19: 40,833,394 (GRCm39)	S191T	probably benign	Het
Clk2	T	A	3: 89,080,852 (GRCm39)		probably null	Het
Cpz	T	C	5: 35,675,000 (GRCm39)	E83G	probably damaging	Het
Cts3	A	G	13: 61,715,434 (GRCm39)	I133T	probably benign	Het
Dars2	C	T	1: 160,874,342 (GRCm39)		probably null	Het
Dsel	A	T	1: 111,788,798 (GRCm39)	V579D	probably damaging	Het
Dync1h1	C	A	12: 110,602,076 (GRCm39)	A2038E	probably damaging	Het
Eaf1	A	G	14: 31,216,777 (GRCm39)		probably benign	Het
Fsip2	A	C	2: 82,828,524 (GRCm39)	I6774L	probably benign	Het
Glis2	T	C	16: 4,431,432 (GRCm39)	F320L	possibly damaging	Het
Hcar1	A	G	5: 124,017,693 (GRCm39)		probably benign	Het
Hectd1	A	T	12: 51,797,104 (GRCm39)	H2211Q	probably benign	Het
Hmcn1	A	G	1: 150,559,496 (GRCm39)	I2385T	probably damaging	Het
Ifi44	T	A	3: 151,438,094 (GRCm39)	M398L	probably benign	Het
Il16	C	T	7: 83,293,249 (GRCm39)	E1273K	probably damaging	Het
Inpp5j	G	A	11: 3,451,065 (GRCm39)	T528I	probably damaging	Het
Kbtbd6	C	T	14: 79,690,627 (GRCm39)	P441S	probably damaging	Het
Kcnt1	C	T	2: 25,753,855 (GRCm39)		probably benign	Het
Kif26b	T	C	1: 178,358,306 (GRCm39)	L139P	probably damaging	Het
Klb	C	T	5: 65,505,974 (GRCm39)	Q74*	probably null	Het
L3mbtl1	G	A	2: 162,808,926 (GRCm39)	V600I	probably benign	Het
Lcp1	C	T	14: 75,447,946 (GRCm39)	A317V	possibly damaging	Het
Lipc	C	T	9: 70,720,029 (GRCm39)	G326D	probably damaging	Het
Mbnl2	T	A	14: 120,616,694 (GRCm39)	F103I	probably benign	Het
Mdm1	G	T	10: 118,000,193 (GRCm39)	E609*	probably null	Het
Med16	A	G	10: 79,744,650 (GRCm39)		probably null	Het
Mga	T	C	2: 119,766,008 (GRCm39)	V1424A	possibly damaging	Het
Mocs2	G	T	13: 114,964,710 (GRCm39)		probably null	Het
Morc1	C	T	16: 48,451,263 (GRCm39)		probably null	Het
Mpc2	T	A	1: 165,307,080 (GRCm39)	W94R	probably damaging	Het
Mrm3	G	A	11: 76,141,002 (GRCm39)	V337I	possibly damaging	Het
N4bp3	T	C	11: 51,536,433 (GRCm39)	H133R	probably benign	Het
Ncam2	G	T	16: 81,420,256 (GRCm39)	G810V	probably damaging	Het
Nipbl	T	C	15: 8,373,090 (GRCm39)	E1052G	possibly damaging	Het
Nlrp12	C	T	7: 3,297,887 (GRCm39)	V95M	probably damaging	Het
Nrip1	T	C	16: 76,090,244 (GRCm39)	N438D	possibly damaging	Het
Nsun4	C	A	4: 115,909,035 (GRCm39)	M508I	probably benign	Het
Pla2g2c	T	C	4: 138,461,650 (GRCm39)	S40P	probably damaging	Het
Plec	A	G	15: 76,082,178 (GRCm39)		probably null	Het
Ppfia2	G	T	10: 106,693,356 (GRCm39)	M620I	possibly damaging	Het
Ppp6c	A	G	2: 39,116,229 (GRCm39)	Y9H	probably damaging	Het
Prkd1	A	T	12: 50,695,617 (GRCm39)	I47N	possibly damaging	Het
Prr14l	T	C	5: 32,988,028 (GRCm39)	D489G	probably benign	Het
Ptch2	T	A	4: 116,971,849 (GRCm39)	Y1124N	probably benign	Het
Ptpra	T	G	2: 130,395,320 (GRCm39)	Y808D	probably damaging	Het
Rint1	T	A	5: 24,020,651 (GRCm39)	F558Y	possibly damaging	Het
Rnf215	T	A	11: 4,089,792 (GRCm39)	C268*	probably null	Het
Slc25a13	T	C	6: 6,181,100 (GRCm39)	E28G	possibly damaging	Het
Slc38a8	G	T	8: 120,226,554 (GRCm39)	Y78*	probably null	Het
Slc4a7	T	C	14: 14,775,000 (GRCm38)	M810T	probably damaging	Het
Slitrk1	A	G	14: 109,150,591 (GRCm39)	V40A	possibly damaging	Het
Sobp	A	T	10: 42,898,831 (GRCm39)	S251R	probably damaging	Het
Spata31d1a	G	A	13: 59,851,015 (GRCm39)	S371L	probably benign	Het
Tada2b	T	C	5: 36,634,180 (GRCm39)	T133A	possibly damaging	Het
Tbc1d20	A	G	2: 152,146,881 (GRCm39)	D90G	probably benign	Het
Tek	T	A	4: 94,715,533 (GRCm39)	I408K	probably benign	Het
Tmem63b	T	C	17: 45,977,517 (GRCm39)	T370A	probably benign	Het
Tmem94	G	T	11: 115,677,082 (GRCm39)	R118L	possibly damaging	Het
Tspan17	C	G	13: 54,940,434 (GRCm39)	L34V	probably benign	Het
Vmn1r238	A	T	18: 3,123,151 (GRCm39)	Y88N	probably damaging	Het
Vmn1r85	A	G	7: 12,818,964 (GRCm39)	I60T	probably damaging	Het
Vmn2r96	T	C	17: 18,803,029 (GRCm39)	M313T	probably benign	Het
Zp3r	G	A	1: 130,511,217 (GRCm39)	S387F	probably benign	Het

Other mutations in Tgfb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Tgfb2	APN	1	186,436,784 (GRCm39)	missense	probably benign	0.39
IGL01304:Tgfb2	APN	1	186,357,670 (GRCm39)	missense	probably damaging	0.99
IGL03028:Tgfb2	APN	1	186,362,806 (GRCm39)	critical splice donor site	probably null
PIT4486001:Tgfb2	UTSW	1	186,422,924 (GRCm39)	missense	probably benign	0.04
R2017:Tgfb2	UTSW	1	186,362,962 (GRCm39)	nonsense	probably null
R2880:Tgfb2	UTSW	1	186,436,752 (GRCm39)	missense	probably damaging	1.00
R4182:Tgfb2	UTSW	1	186,361,222 (GRCm39)	missense	possibly damaging	0.95
R4292:Tgfb2	UTSW	1	186,364,735 (GRCm39)	missense	probably damaging	1.00
R4478:Tgfb2	UTSW	1	186,364,696 (GRCm39)	missense	probably damaging	1.00
R4801:Tgfb2	UTSW	1	186,361,110 (GRCm39)	nonsense	probably null
R4802:Tgfb2	UTSW	1	186,361,110 (GRCm39)	nonsense	probably null
R5247:Tgfb2	UTSW	1	186,382,111 (GRCm39)	splice site	probably null
R5254:Tgfb2	UTSW	1	186,436,680 (GRCm39)	missense	probably damaging	1.00
R5614:Tgfb2	UTSW	1	186,357,710 (GRCm39)	missense	probably benign	0.21
R5988:Tgfb2	UTSW	1	186,436,778 (GRCm39)	missense	probably benign	0.05
R6898:Tgfb2	UTSW	1	186,364,697 (GRCm39)	missense	probably damaging	1.00
R6961:Tgfb2	UTSW	1	186,382,032 (GRCm39)	missense	possibly damaging	0.67
R7098:Tgfb2	UTSW	1	186,362,834 (GRCm39)	missense	probably damaging	1.00
R7729:Tgfb2	UTSW	1	186,362,954 (GRCm39)	missense	possibly damaging	0.94
R8167:Tgfb2	UTSW	1	186,422,942 (GRCm39)	missense	possibly damaging	0.94
R8825:Tgfb2	UTSW	1	186,361,136 (GRCm39)	missense	probably damaging	1.00
R8884:Tgfb2	UTSW	1	186,364,907 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAAGTGTCTCACGCACTCC -3'
(R):5'- TGCTTCTCCTGGAACCAAACAC -3'

Sequencing Primer
(F):5'- TGTCTCACGCACTCCCACAAC -3'
(R):5'- CACACATGTTGATTTTAGTTTGTTCC -3'

Posted On

2019-09-13