Mutagenetix > Incidental Mutations

Incidental Mutation 'R7346:Hectd1'

570216

Institutional Source

Beutler Lab

Gene Symbol

Hectd1

Ensembl Gene

ENSMUSG00000035247

Gene Name

HECT domain E3 ubiquitin protein ligase 1

Synonyms

b2b327Clo, opm, A630086P08Rik

MMRRC Submission

Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7346 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

51743722-51829536 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 51750321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 2211 (H2211Q)

Ref Sequence

ENSEMBL: ENSMUSP00000136449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]

AlphaFold

Q69ZR2

Predicted Effect

probably benign
Transcript: ENSMUST00000042052
AA Change: H2206Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: H2206Q

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	395	424	1.44e-1	SMART
ANK	426	455	2.81e-4	SMART
ANK	459	488	1.55e2	SMART
low complexity region	490	509	N/A	INTRINSIC
low complexity region	630	654	N/A	INTRINSIC
low complexity region	707	723	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
Pfam:Sad1_UNC	1107	1240	9.2e-27	PFAM
low complexity region	1259	1271	N/A	INTRINSIC
Pfam:MIB_HERC2	1277	1338	7.6e-27	PFAM
low complexity region	1373	1401	N/A	INTRINSIC
low complexity region	1441	1458	N/A	INTRINSIC
low complexity region	1484	1495	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1600	1630	N/A	INTRINSIC
low complexity region	1633	1651	N/A	INTRINSIC
low complexity region	1674	1703	N/A	INTRINSIC
low complexity region	1745	1752	N/A	INTRINSIC
PDB:2LC3\|A	1879	1966	4e-57	PDB
low complexity region	2101	2117	N/A	INTRINSIC
HECTc	2143	2610	8.32e-76	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179265
AA Change: H2211Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: H2211Q

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	396	425	1.44e-1	SMART
ANK	427	456	2.81e-4	SMART
ANK	460	489	1.55e2	SMART
low complexity region	491	510	N/A	INTRINSIC
low complexity region	631	655	N/A	INTRINSIC
low complexity region	708	724	N/A	INTRINSIC
low complexity region	822	833	N/A	INTRINSIC
Pfam:Sad1_UNC	1112	1245	1.3e-26	PFAM
low complexity region	1264	1276	N/A	INTRINSIC
Pfam:MIB_HERC2	1282	1341	5.3e-26	PFAM
low complexity region	1378	1406	N/A	INTRINSIC
low complexity region	1446	1463	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1513	1529	N/A	INTRINSIC
low complexity region	1605	1635	N/A	INTRINSIC
low complexity region	1638	1656	N/A	INTRINSIC
low complexity region	1679	1708	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
PDB:2LC3\|A	1884	1971	3e-57	PDB
low complexity region	2106	2122	N/A	INTRINSIC
HECTc	2148	2618	4.5e-72	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.1%

Validation Efficiency

100% (71/71)

MGI Phenotype

PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]

Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	G	A	9: 56,007,303	P52S	unknown	Het
Adarb2	A	G	13: 8,570,384	E302G	probably damaging	Het
Adgrf5	T	A	17: 43,451,179	L1255H	probably damaging	Het
Adra1a	T	A	14: 66,638,284	I236N	probably benign	Het
As3mt	T	C	19: 46,720,452	F295S	probably damaging	Het
Bmp5	G	A	9: 75,873,360	R313Q	probably damaging	Het
Ccnj	T	A	19: 40,844,950	S191T	probably benign	Het
Clk2	T	A	3: 89,173,545		probably null	Het
Cpz	T	C	5: 35,517,656	E83G	probably damaging	Het
Cts3	A	G	13: 61,567,620	I133T	probably benign	Het
Dars2	C	T	1: 161,046,772		probably null	Het
Dsel	A	T	1: 111,861,068	V579D	probably damaging	Het
Dync1h1	C	A	12: 110,635,642	A2038E	probably damaging	Het
Eaf1	A	G	14: 31,494,820		probably benign	Het
Fsip2	A	C	2: 82,998,180	I6774L	probably benign	Het
Glis2	T	C	16: 4,613,568	F320L	possibly damaging	Het
Hcar1	A	G	5: 123,879,630		probably benign	Het
Hmcn1	A	G	1: 150,683,745	I2385T	probably damaging	Het
Ifi44	T	A	3: 151,732,457	M398L	probably benign	Het
Il16	C	T	7: 83,644,041	E1273K	probably damaging	Het
Inpp5j	G	A	11: 3,501,065	T528I	probably damaging	Het
Kbtbd6	C	T	14: 79,453,187	P441S	probably damaging	Het
Kcnt1	C	T	2: 25,863,843		probably benign	Het
Kif26b	T	C	1: 178,530,741	L139P	probably damaging	Het
Klb	C	T	5: 65,348,631	Q74*	probably null	Het
L3mbtl1	G	A	2: 162,967,006	V600I	probably benign	Het
Lcp1	C	T	14: 75,210,506	A317V	possibly damaging	Het
Lipc	C	T	9: 70,812,747	G326D	probably damaging	Het
Mbnl2	T	A	14: 120,379,282	F103I	probably benign	Het
Mdm1	G	T	10: 118,164,288	E609*	probably null	Het
Med16	A	G	10: 79,908,816		probably null	Het
Mga	T	C	2: 119,935,527	V1424A	possibly damaging	Het
Mocs2	G	T	13: 114,828,174		probably null	Het
Morc1	C	T	16: 48,630,900		probably null	Het
Mpc2	T	A	1: 165,479,511	W94R	probably damaging	Het
Mrm3	G	A	11: 76,250,176	V337I	possibly damaging	Het
N4bp3	T	C	11: 51,645,606	H133R	probably benign	Het
Ncam2	G	T	16: 81,623,368	G810V	probably damaging	Het
Nipbl	T	C	15: 8,343,606	E1052G	possibly damaging	Het
Nlrp12	C	T	7: 3,249,257	V95M	probably damaging	Het
Nrip1	T	C	16: 76,293,356	N438D	possibly damaging	Het
Nsun4	C	A	4: 116,051,838	M508I	probably benign	Het
Pla2g2c	T	C	4: 138,734,339	S40P	probably damaging	Het
Plec	A	G	15: 76,197,978		probably null	Het
Ppfia2	G	T	10: 106,857,495	M620I	possibly damaging	Het
Ppp6c	A	G	2: 39,226,217	Y9H	probably damaging	Het
Prkd1	A	T	12: 50,648,834	I47N	possibly damaging	Het
Prr14l	T	C	5: 32,830,684	D489G	probably benign	Het
Ptch2	T	A	4: 117,114,652	Y1124N	probably benign	Het
Ptpra	T	G	2: 130,553,400	Y808D	probably damaging	Het
Rint1	T	A	5: 23,815,653	F558Y	possibly damaging	Het
Rnf215	T	A	11: 4,139,792	C268*	probably null	Het
Slc25a13	T	C	6: 6,181,100	E28G	possibly damaging	Het
Slc38a8	G	T	8: 119,499,815	Y78*	probably null	Het
Slc4a7	T	C	14: 14,775,000	M810T	probably damaging	Het
Slitrk1	A	G	14: 108,913,159	V40A	possibly damaging	Het
Sobp	A	T	10: 43,022,835	S251R	probably damaging	Het
Spata31d1a	G	A	13: 59,703,201	S371L	probably benign	Het
Tada2b	T	C	5: 36,476,836	T133A	possibly damaging	Het
Tbc1d20	A	G	2: 152,304,961	D90G	probably benign	Het
Tek	T	A	4: 94,827,296	I408K	probably benign	Het
Tgfb2	A	G	1: 186,649,880	F150S	probably benign	Het
Tmem63b	T	C	17: 45,666,591	T370A	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tspan17	C	G	13: 54,792,621	L34V	probably benign	Het
Vmn1r238	A	T	18: 3,123,151	Y88N	probably damaging	Het
Vmn1r85	A	G	7: 13,085,037	I60T	probably damaging	Het
Vmn2r96	T	C	17: 18,582,767	M313T	probably benign	Het
Zp3r	G	A	1: 130,583,480	S387F	probably benign	Het

Other mutations in Hectd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Hectd1	APN	12	51769108	missense	possibly damaging	0.94
IGL00402:Hectd1	APN	12	51759432	missense	probably benign
IGL00419:Hectd1	APN	12	51764035	missense	probably damaging	0.99
IGL00518:Hectd1	APN	12	51776489	splice site	probably benign
IGL00565:Hectd1	APN	12	51790398	missense	probably damaging	0.97
IGL00574:Hectd1	APN	12	51774004	missense	probably benign	0.17
IGL00576:Hectd1	APN	12	51759309	missense	probably damaging	0.99
IGL00788:Hectd1	APN	12	51748788	missense	probably damaging	0.99
IGL00978:Hectd1	APN	12	51791390	missense	possibly damaging	0.95
IGL01328:Hectd1	APN	12	51761121	missense	probably damaging	1.00
IGL01337:Hectd1	APN	12	51802274	missense	possibly damaging	0.95
IGL01634:Hectd1	APN	12	51803779	missense	probably damaging	0.98
IGL01731:Hectd1	APN	12	51802810	missense	possibly damaging	0.59
IGL01920:Hectd1	APN	12	51782554	missense	probably damaging	0.99
IGL01951:Hectd1	APN	12	51794497	nonsense	probably null
IGL01994:Hectd1	APN	12	51797942	missense	probably damaging	0.99
IGL02140:Hectd1	APN	12	51774137	missense	probably damaging	0.99
IGL02150:Hectd1	APN	12	51769191	missense	probably damaging	0.97
IGL02156:Hectd1	APN	12	51754133	splice site	probably benign
IGL02177:Hectd1	APN	12	51772320	missense	probably damaging	0.99
IGL02502:Hectd1	APN	12	51797852	missense	possibly damaging	0.77
IGL02505:Hectd1	APN	12	51800713	critical splice donor site	probably null
IGL02519:Hectd1	APN	12	51769111	missense	probably damaging	0.99
IGL02624:Hectd1	APN	12	51762450	missense	possibly damaging	0.61
IGL02833:Hectd1	APN	12	51764081	missense	probably damaging	0.96
IGL02851:Hectd1	APN	12	51767640	missense	possibly damaging	0.94
IGL02866:Hectd1	APN	12	51790613	missense	probably damaging	1.00
IGL02981:Hectd1	APN	12	51768887	missense	possibly damaging	0.70
IGL02987:Hectd1	APN	12	51744767	missense	probably damaging	1.00
IGL02999:Hectd1	APN	12	51827422	missense	possibly damaging	0.77
IGL03071:Hectd1	APN	12	51769174	missense	probably benign	0.00
IGL03078:Hectd1	APN	12	51802236	missense	probably damaging	0.98
IGL03299:Hectd1	APN	12	51800888	splice site	probably benign
3-1:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R0039:Hectd1	UTSW	12	51753825	missense	possibly damaging	0.83
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0268:Hectd1	UTSW	12	51769107	missense	probably damaging	0.99
R0268:Hectd1	UTSW	12	51769108	missense	possibly damaging	0.94
R0409:Hectd1	UTSW	12	51782556	missense	possibly damaging	0.59
R1019:Hectd1	UTSW	12	51748657	missense	probably damaging	0.99
R1072:Hectd1	UTSW	12	51761072	missense	probably benign	0.11
R1087:Hectd1	UTSW	12	51776572	missense	probably damaging	0.99
R1165:Hectd1	UTSW	12	51764164	splice site	probably benign
R1350:Hectd1	UTSW	12	51762434	missense	probably benign
R1553:Hectd1	UTSW	12	51773878	missense	probably damaging	0.98
R1666:Hectd1	UTSW	12	51753824	missense	possibly damaging	0.91
R1676:Hectd1	UTSW	12	51744788	missense	probably damaging	1.00
R1694:Hectd1	UTSW	12	51744592	missense	probably damaging	1.00
R1778:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R1856:Hectd1	UTSW	12	51744794	missense	probably damaging	1.00
R1859:Hectd1	UTSW	12	51806567	missense	probably damaging	1.00
R1884:Hectd1	UTSW	12	51800955	missense	probably benign	0.00
R1982:Hectd1	UTSW	12	51785841	missense	probably damaging	0.97
R2034:Hectd1	UTSW	12	51757116	splice site	probably null
R2061:Hectd1	UTSW	12	51794444	missense	probably damaging	0.99
R2078:Hectd1	UTSW	12	51748542	missense	probably damaging	0.99
R2176:Hectd1	UTSW	12	51745494	missense	probably damaging	1.00
R2210:Hectd1	UTSW	12	51806462	missense	probably damaging	0.99
R2248:Hectd1	UTSW	12	51806471	missense	probably damaging	0.99
R2282:Hectd1	UTSW	12	51769008	missense	possibly damaging	0.95
R2402:Hectd1	UTSW	12	51745534	missense	probably benign	0.01
R3876:Hectd1	UTSW	12	51768730	missense	probably damaging	0.98
R4027:Hectd1	UTSW	12	51802436	critical splice acceptor site	probably null
R4085:Hectd1	UTSW	12	51774750	missense	possibly damaging	0.93
R4115:Hectd1	UTSW	12	51768723	nonsense	probably null
R4116:Hectd1	UTSW	12	51768723	nonsense	probably null
R4169:Hectd1	UTSW	12	51790225	missense	probably damaging	0.97
R4434:Hectd1	UTSW	12	51752052	missense	probably damaging	1.00
R4507:Hectd1	UTSW	12	51790493	missense	probably damaging	0.97
R4578:Hectd1	UTSW	12	51751932	missense	probably damaging	1.00
R4579:Hectd1	UTSW	12	51744573	missense	probably damaging	0.97
R4709:Hectd1	UTSW	12	51787912	missense	possibly damaging	0.94
R4812:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R4883:Hectd1	UTSW	12	51784247	nonsense	probably null
R4885:Hectd1	UTSW	12	51800722	missense	probably damaging	0.97
R4975:Hectd1	UTSW	12	51762497	missense	probably benign	0.02
R4983:Hectd1	UTSW	12	51784262	missense	probably benign	0.01
R5007:Hectd1	UTSW	12	51802660	missense	possibly damaging	0.95
R5046:Hectd1	UTSW	12	51750388	missense	probably damaging	1.00
R5062:Hectd1	UTSW	12	51744879	missense	probably damaging	0.98
R5164:Hectd1	UTSW	12	51827489	start codon destroyed	probably null	0.60
R5213:Hectd1	UTSW	12	51802533	critical splice donor site	probably null
R5535:Hectd1	UTSW	12	51802326	missense	probably damaging	0.98
R5776:Hectd1	UTSW	12	51764114	missense	possibly damaging	0.91
R5846:Hectd1	UTSW	12	51773835	missense	probably damaging	0.99
R5907:Hectd1	UTSW	12	51798754	missense	probably damaging	0.98
R5911:Hectd1	UTSW	12	51802252	missense	probably damaging	0.99
R5919:Hectd1	UTSW	12	51769072	missense	probably damaging	0.98
R6051:Hectd1	UTSW	12	51754104	missense	probably benign
R6141:Hectd1	UTSW	12	51746092	critical splice donor site	probably null
R6172:Hectd1	UTSW	12	51769282	missense	probably damaging	1.00
R6194:Hectd1	UTSW	12	51748445	missense	probably damaging	0.99
R6356:Hectd1	UTSW	12	51744619	missense	probably damaging	1.00
R6795:Hectd1	UTSW	12	51794487	missense	possibly damaging	0.94
R6909:Hectd1	UTSW	12	51764162	splice site	probably null
R6971:Hectd1	UTSW	12	51748743	nonsense	probably null
R7079:Hectd1	UTSW	12	51787855	missense	possibly damaging	0.96
R7104:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R7171:Hectd1	UTSW	12	51759297	missense	probably damaging	0.99
R7296:Hectd1	UTSW	12	51785852	missense	possibly damaging	0.73
R7355:Hectd1	UTSW	12	51791298	missense	possibly damaging	0.72
R7468:Hectd1	UTSW	12	51744805	splice site	probably null
R7531:Hectd1	UTSW	12	51806367	missense	probably benign	0.33
R7532:Hectd1	UTSW	12	51790450	missense	probably damaging	0.98
R7755:Hectd1	UTSW	12	51802220	missense	possibly damaging	0.86
R7807:Hectd1	UTSW	12	51745388	missense	probably damaging	1.00
R7842:Hectd1	UTSW	12	51772560	missense	probably damaging	0.99
R7922:Hectd1	UTSW	12	51790195	nonsense	probably null
R8059:Hectd1	UTSW	12	51790378	missense	possibly damaging	0.53
R8085:Hectd1	UTSW	12	51748896	missense	probably damaging	0.97
R8145:Hectd1	UTSW	12	51784233	missense	possibly damaging	0.72
R8157:Hectd1	UTSW	12	51791290	missense	possibly damaging	0.53
R8405:Hectd1	UTSW	12	51827395	missense	probably benign	0.01
R8505:Hectd1	UTSW	12	51750362	missense	probably damaging	1.00
R8511:Hectd1	UTSW	12	51787871	missense	probably benign	0.01
R8697:Hectd1	UTSW	12	51772537	critical splice donor site	probably benign
R8725:Hectd1	UTSW	12	51802217	missense	possibly damaging	0.92
R8727:Hectd1	UTSW	12	51802217	missense	possibly damaging	0.92
R8911:Hectd1	UTSW	12	51748833	missense	probably damaging	0.99
R8983:Hectd1	UTSW	12	51744627	missense	probably damaging	0.97
R9037:Hectd1	UTSW	12	51785882	missense	possibly damaging	0.85
R9219:Hectd1	UTSW	12	51753829	missense	probably damaging	0.99
R9413:Hectd1	UTSW	12	51746097	nonsense	probably null
R9456:Hectd1	UTSW	12	51785801	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCGAGGTTCAGTATTGGAAG -3'
(R):5'- TGTTACACTTAGTGACCCTGTC -3'

Sequencing Primer
(F):5'- TGAGAACCTGGGCTCAGTTCTC -3'
(R):5'- ACACTTAGTGACCCTGTCTTTATC -3'

Posted On

2019-09-13