Mutagenetix > Incidental Mutation

Incidental Mutation 'R0645:Zdbf2'

57022

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

038830-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R0645 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63304950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 829 (D829E)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: D829E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: D829E

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083151

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: D829E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: D829E

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.1369

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

99% (94/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	C	T	2: 111,214,583		probably null	Het
Adam18	G	T	8: 24,672,120	Y46*	probably null	Het
Adam26b	A	C	8: 43,520,487	C493G	probably damaging	Het
Ak5	A	T	3: 152,653,615	L182Q	probably damaging	Het
Akt1s1	T	C	7: 44,849,221		probably benign	Het
Amhr2	G	T	15: 102,446,428	G133C	probably damaging	Het
Btbd9	A	T	17: 30,524,967	L187Q	probably damaging	Het
Ccdc117	A	T	11: 5,534,385		probably benign	Het
Ccdc138	A	T	10: 58,575,720	I637F	probably damaging	Het
Ccdc162	A	G	10: 41,586,411		probably benign	Het
Cdc25b	C	A	2: 131,191,613	H157Q	probably benign	Het
Cdon	A	G	9: 35,477,083		probably null	Het
Cdt1	G	A	8: 122,572,145		probably benign	Het
Cep350	C	T	1: 155,940,712		probably null	Het
Cfb	T	C	17: 34,860,016	K831R	probably benign	Het
Cldn4	C	A	5: 134,946,791		probably benign	Het
Cntnap5b	T	C	1: 100,072,042		probably benign	Het
Cyp27b1	T	G	10: 127,049,098	S77A	probably benign	Het
Dlc1	T	C	8: 36,574,049	D1342G	possibly damaging	Het
Dlgap4	A	G	2: 156,761,879	H887R	probably damaging	Het
Duox2	A	G	2: 122,292,658	I503T	probably damaging	Het
Elmsan1	G	T	12: 84,158,303	N834K	possibly damaging	Het
Eml4	T	C	17: 83,463,493		probably benign	Het
Ermap	A	G	4: 119,185,691	S212P	probably benign	Het
Esrrg	T	A	1: 188,043,341	C22S	probably benign	Het
Evx2	T	A	2: 74,657,894	Y194F	possibly damaging	Het
Fam126a	C	T	5: 23,979,508	G242D	probably damaging	Het
Fbn2	T	G	18: 58,058,389	D1554A	probably damaging	Het
Flrt1	G	A	19: 7,097,143		probably benign	Het
Fndc5	A	G	4: 129,139,837		probably benign	Het
Frem1	A	T	4: 82,989,166	I837N	probably damaging	Het
Fzd10	G	T	5: 128,602,598	A461S	possibly damaging	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gbp7	A	G	3: 142,538,165		probably null	Het
Gm10639	T	C	9: 78,299,021	I75T	possibly damaging	Het
Gm5919	T	A	9: 83,883,383	C91S	unknown	Het
Gm597	T	A	1: 28,776,930	N674Y	probably damaging	Het
Gpr31b	A	T	17: 13,052,206	C25*	probably null	Het
Grb10	A	G	11: 11,936,755	S505P	probably damaging	Het
Grm4	A	T	17: 27,435,209	V542E	probably damaging	Het
Hivep3	G	A	4: 120,097,334	R949H	possibly damaging	Het
Invs	A	T	4: 48,407,653	M543L	probably benign	Het
Kcnk2	T	C	1: 189,256,730		probably null	Het
Kdm6b	A	T	11: 69,405,018	S808T	unknown	Het
Klhl30	C	T	1: 91,355,506	R277W	probably damaging	Het
Lama1	A	G	17: 67,773,712	Q1245R	probably benign	Het
Lingo3	G	T	10: 80,835,335	H254N	probably benign	Het
Lzts1	A	T	8: 69,135,740	H521Q	possibly damaging	Het
Map3k19	A	C	1: 127,822,182	I1144S	possibly damaging	Het
Mast2	A	G	4: 116,307,987	S1411P	probably damaging	Het
Mast2	T	C	4: 116,312,846		probably benign	Het
Mesp1	G	T	7: 79,792,580	S225R	possibly damaging	Het
Micu1	A	G	10: 59,839,681	T366A	possibly damaging	Het
Mknk2	T	C	10: 80,671,908		probably null	Het
Msh5	A	G	17: 35,039,223	L309P	probably damaging	Het
Myo7b	T	C	18: 31,994,909	I577V	probably benign	Het
Myom2	T	A	8: 15,117,698	D1094E	probably damaging	Het
Nedd1	T	C	10: 92,691,831		probably null	Het
Neu4	T	C	1: 94,022,469	L50S	probably damaging	Het
Noa1	T	C	5: 77,309,875	Y61C	probably benign	Het
Nr1h4	A	T	10: 89,506,528	M30K	probably benign	Het
Nsd3	A	G	8: 25,709,069	I1219V	probably benign	Het
Nup188	T	A	2: 30,343,466		probably null	Het
Olfr1039	A	G	2: 86,131,034	S210P	probably damaging	Het
Olfr1123	T	A	2: 87,418,268	Y71*	probably null	Het
Olfr420	A	T	1: 174,159,354	T194S	probably benign	Het
Olfr784	T	A	10: 129,388,293	I220N	possibly damaging	Het
Pbk	G	A	14: 65,813,796		probably benign	Het
Pcnx2	G	A	8: 125,760,720	T1848M	possibly damaging	Het
Pdzd7	C	T	19: 45,045,475	G57R	possibly damaging	Het
Pik3r4	C	A	9: 105,669,187		probably benign	Het
Plce1	A	G	19: 38,777,989	S2153G	probably damaging	Het
Pphln1	G	A	15: 93,420,311	V34M	possibly damaging	Het
Prrc2a	T	C	17: 35,156,332	D1114G	probably damaging	Het
Prss16	T	C	13: 22,009,376		probably benign	Het
Rtp3	T	C	9: 110,987,100	K128E	probably damaging	Het
Scn3a	T	A	2: 65,524,850	I241F	possibly damaging	Het
Setd1a	G	A	7: 127,787,210	V336I	probably damaging	Het
Sfpq	A	G	4: 127,022,969	I320V	possibly damaging	Het
Skint5	A	T	4: 113,763,482	D678E	unknown	Het
Slc12a9	G	A	5: 137,315,376	P774S	probably benign	Het
Slc25a54	C	G	3: 109,112,165	L362V	possibly damaging	Het
Smarcd1	A	G	15: 99,707,386		probably null	Het
Suco	A	T	1: 161,834,114	M916K	probably damaging	Het
Tiam2	T	C	17: 3,514,698	S1404P	possibly damaging	Het
Topors	T	C	4: 40,260,333	T984A	unknown	Het
Trabd2b	A	T	4: 114,586,570	K308M	probably damaging	Het
Trmo	A	T	4: 46,377,083		probably benign	Het
Trpc3	A	T	3: 36,671,505	D107E	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Uggt2	A	C	14: 119,057,598	Y539D	probably benign	Het
Wwc2	T	G	8: 47,900,639		probably benign	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTGTCAGTTACTGAGCGGTCTCTG -3'
(R):5'- AGGTTCTGTCACTGGGTGAGAAGC -3'

Sequencing Primer
(F):5'- CCTGGAAGATGAAAACTGTGTGTC -3'
(R):5'- TGGGATCTTCAGAACATCCG -3'

Posted On

2013-07-11