Incidental Mutation 'R7346:Spata31d1a'
ID570220
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7346 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59703201 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 371 (S371L)
Ref Sequence ENSEMBL: ENSMUSP00000128533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect probably benign
Transcript: ENSMUST00000066510
AA Change: S371L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: S371L

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect probably benign
Transcript: ENSMUST00000224982
AA Change: S371L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 56,007,303 P52S unknown Het
Adarb2 A G 13: 8,570,384 E302G probably damaging Het
Adgrf5 T A 17: 43,451,179 L1255H probably damaging Het
Adra1a T A 14: 66,638,284 I236N probably benign Het
As3mt T C 19: 46,720,452 F295S probably damaging Het
Bmp5 G A 9: 75,873,360 R313Q probably damaging Het
Ccnj T A 19: 40,844,950 S191T probably benign Het
Clk2 T A 3: 89,173,545 probably null Het
Cpz T C 5: 35,517,656 E83G probably damaging Het
Cts3 A G 13: 61,567,620 I133T probably benign Het
Dars2 C T 1: 161,046,772 probably null Het
Dsel A T 1: 111,861,068 V579D probably damaging Het
Dync1h1 C A 12: 110,635,642 A2038E probably damaging Het
Eaf1 A G 14: 31,494,820 probably benign Het
Fsip2 A C 2: 82,998,180 I6774L probably benign Het
Glis2 T C 16: 4,613,568 F320L possibly damaging Het
Hcar1 A G 5: 123,879,630 probably benign Het
Hectd1 A T 12: 51,750,321 H2211Q probably benign Het
Hmcn1 A G 1: 150,683,745 I2385T probably damaging Het
Ifi44 T A 3: 151,732,457 M398L probably benign Het
Il16 C T 7: 83,644,041 E1273K probably damaging Het
Inpp5j G A 11: 3,501,065 T528I probably damaging Het
Kbtbd6 C T 14: 79,453,187 P441S probably damaging Het
Kcnt1 C T 2: 25,863,843 probably benign Het
Kif26b T C 1: 178,530,741 L139P probably damaging Het
Klb C T 5: 65,348,631 Q74* probably null Het
L3mbtl1 G A 2: 162,967,006 V600I probably benign Het
Lcp1 C T 14: 75,210,506 A317V possibly damaging Het
Lipc C T 9: 70,812,747 G326D probably damaging Het
Mbnl2 T A 14: 120,379,282 F103I probably benign Het
Mdm1 G T 10: 118,164,288 E609* probably null Het
Med16 A G 10: 79,908,816 probably null Het
Mga T C 2: 119,935,527 V1424A possibly damaging Het
Mocs2 G T 13: 114,828,174 probably null Het
Morc1 C T 16: 48,630,900 probably null Het
Mpc2 T A 1: 165,479,511 W94R probably damaging Het
Mrm3 G A 11: 76,250,176 V337I possibly damaging Het
N4bp3 T C 11: 51,645,606 H133R probably benign Het
Ncam2 G T 16: 81,623,368 G810V probably damaging Het
Nipbl T C 15: 8,343,606 E1052G possibly damaging Het
Nlrp12 C T 7: 3,249,257 V95M probably damaging Het
Nrip1 T C 16: 76,293,356 N438D possibly damaging Het
Nsun4 C A 4: 116,051,838 M508I probably benign Het
Pla2g2c T C 4: 138,734,339 S40P probably damaging Het
Plec A G 15: 76,197,978 probably null Het
Ppfia2 G T 10: 106,857,495 M620I possibly damaging Het
Ppp6c A G 2: 39,226,217 Y9H probably damaging Het
Prkd1 A T 12: 50,648,834 I47N possibly damaging Het
Prr14l T C 5: 32,830,684 D489G probably benign Het
Ptch2 T A 4: 117,114,652 Y1124N probably benign Het
Ptpra T G 2: 130,553,400 Y808D probably damaging Het
Rint1 T A 5: 23,815,653 F558Y possibly damaging Het
Rnf215 T A 11: 4,139,792 C268* probably null Het
Slc25a13 T C 6: 6,181,100 E28G possibly damaging Het
Slc38a8 G T 8: 119,499,815 Y78* probably null Het
Slc4a7 T C 14: 14,775,000 M810T probably damaging Het
Slitrk1 A G 14: 108,913,159 V40A possibly damaging Het
Sobp A T 10: 43,022,835 S251R probably damaging Het
Tada2b T C 5: 36,476,836 T133A possibly damaging Het
Tbc1d20 A G 2: 152,304,961 D90G probably benign Het
Tek T A 4: 94,827,296 I408K probably benign Het
Tgfb2 A G 1: 186,649,880 F150S probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tspan17 C G 13: 54,792,621 L34V probably benign Het
Vmn1r238 A T 18: 3,123,151 Y88N probably damaging Het
Vmn1r85 A G 7: 13,085,037 I60T probably damaging Het
Vmn2r96 T C 17: 18,582,767 M313T probably benign Het
Zp3r G A 1: 130,583,480 S387F probably benign Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 splice site probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
R7271:Spata31d1a UTSW 13 59702099 missense probably benign 0.00
R7556:Spata31d1a UTSW 13 59701984 missense probably benign 0.00
R7581:Spata31d1a UTSW 13 59704139 critical splice donor site probably null
R7891:Spata31d1a UTSW 13 59700325 missense possibly damaging 0.96
R7995:Spata31d1a UTSW 13 59701110 missense probably benign 0.06
R8379:Spata31d1a UTSW 13 59702854 missense probably benign 0.00
Z1177:Spata31d1a UTSW 13 59703085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCAGCCTCATGTTTCAGG -3'
(R):5'- ACTCCTATGCTTCTCAGGGC -3'

Sequencing Primer
(F):5'- AGCCTCATGTTTCAGGGACTCAC -3'
(R):5'- TTCTCAGGGCTCATACCAGG -3'
Posted On2019-09-13