Mutagenetix > Incidental Mutation

Incidental Mutation 'R7346:Lcp1'

570225

Institutional Source

Beutler Lab

Gene Symbol

Lcp1

Ensembl Gene

ENSMUSG00000021998

Gene Name

lymphocyte cytosolic protein 1

Synonyms

D14Ertd310e, L-fimbrin, Pls2, L-plastin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7346 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75131101-75230842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 75210506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 317 (A317V)

Ref Sequence

ENSEMBL: ENSMUSP00000121201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]

AlphaFold

Q61233

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124499
AA Change: A317V

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: A317V

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131802
AA Change: A317V

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: A317V

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145303
AA Change: A317V

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: A317V

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.1%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	G	A	9: 56,007,303	P52S	unknown	Het
Adarb2	A	G	13: 8,570,384	E302G	probably damaging	Het
Adgrf5	T	A	17: 43,451,179	L1255H	probably damaging	Het
Adra1a	T	A	14: 66,638,284	I236N	probably benign	Het
As3mt	T	C	19: 46,720,452	F295S	probably damaging	Het
Bmp5	G	A	9: 75,873,360	R313Q	probably damaging	Het
Ccnj	T	A	19: 40,844,950	S191T	probably benign	Het
Clk2	T	A	3: 89,173,545		probably null	Het
Cpz	T	C	5: 35,517,656	E83G	probably damaging	Het
Cts3	A	G	13: 61,567,620	I133T	probably benign	Het
Dars2	C	T	1: 161,046,772		probably null	Het
Dsel	A	T	1: 111,861,068	V579D	probably damaging	Het
Dync1h1	C	A	12: 110,635,642	A2038E	probably damaging	Het
Eaf1	A	G	14: 31,494,820		probably benign	Het
Fsip2	A	C	2: 82,998,180	I6774L	probably benign	Het
Glis2	T	C	16: 4,613,568	F320L	possibly damaging	Het
Hcar1	A	G	5: 123,879,630		probably benign	Het
Hectd1	A	T	12: 51,750,321	H2211Q	probably benign	Het
Hmcn1	A	G	1: 150,683,745	I2385T	probably damaging	Het
Ifi44	T	A	3: 151,732,457	M398L	probably benign	Het
Il16	C	T	7: 83,644,041	E1273K	probably damaging	Het
Inpp5j	G	A	11: 3,501,065	T528I	probably damaging	Het
Kbtbd6	C	T	14: 79,453,187	P441S	probably damaging	Het
Kcnt1	C	T	2: 25,863,843		probably benign	Het
Kif26b	T	C	1: 178,530,741	L139P	probably damaging	Het
Klb	C	T	5: 65,348,631	Q74*	probably null	Het
L3mbtl1	G	A	2: 162,967,006	V600I	probably benign	Het
Lipc	C	T	9: 70,812,747	G326D	probably damaging	Het
Mbnl2	T	A	14: 120,379,282	F103I	probably benign	Het
Mdm1	G	T	10: 118,164,288	E609*	probably null	Het
Med16	A	G	10: 79,908,816		probably null	Het
Mga	T	C	2: 119,935,527	V1424A	possibly damaging	Het
Mocs2	G	T	13: 114,828,174		probably null	Het
Morc1	C	T	16: 48,630,900		probably null	Het
Mpc2	T	A	1: 165,479,511	W94R	probably damaging	Het
Mrm3	G	A	11: 76,250,176	V337I	possibly damaging	Het
N4bp3	T	C	11: 51,645,606	H133R	probably benign	Het
Ncam2	G	T	16: 81,623,368	G810V	probably damaging	Het
Nipbl	T	C	15: 8,343,606	E1052G	possibly damaging	Het
Nlrp12	C	T	7: 3,249,257	V95M	probably damaging	Het
Nrip1	T	C	16: 76,293,356	N438D	possibly damaging	Het
Nsun4	C	A	4: 116,051,838	M508I	probably benign	Het
Pla2g2c	T	C	4: 138,734,339	S40P	probably damaging	Het
Plec	A	G	15: 76,197,978		probably null	Het
Ppfia2	G	T	10: 106,857,495	M620I	possibly damaging	Het
Ppp6c	A	G	2: 39,226,217	Y9H	probably damaging	Het
Prkd1	A	T	12: 50,648,834	I47N	possibly damaging	Het
Prr14l	T	C	5: 32,830,684	D489G	probably benign	Het
Ptch2	T	A	4: 117,114,652	Y1124N	probably benign	Het
Ptpra	T	G	2: 130,553,400	Y808D	probably damaging	Het
Rint1	T	A	5: 23,815,653	F558Y	possibly damaging	Het
Rnf215	T	A	11: 4,139,792	C268*	probably null	Het
Slc25a13	T	C	6: 6,181,100	E28G	possibly damaging	Het
Slc38a8	G	T	8: 119,499,815	Y78*	probably null	Het
Slc4a7	T	C	14: 14,775,000	M810T	probably damaging	Het
Slitrk1	A	G	14: 108,913,159	V40A	possibly damaging	Het
Sobp	A	T	10: 43,022,835	S251R	probably damaging	Het
Spata31d1a	G	A	13: 59,703,201	S371L	probably benign	Het
Tada2b	T	C	5: 36,476,836	T133A	possibly damaging	Het
Tbc1d20	A	G	2: 152,304,961	D90G	probably benign	Het
Tek	T	A	4: 94,827,296	I408K	probably benign	Het
Tgfb2	A	G	1: 186,649,880	F150S	probably benign	Het
Tmem63b	T	C	17: 45,666,591	T370A	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tspan17	C	G	13: 54,792,621	L34V	probably benign	Het
Vmn1r238	A	T	18: 3,123,151	Y88N	probably damaging	Het
Vmn1r85	A	G	7: 13,085,037	I60T	probably damaging	Het
Vmn2r96	T	C	17: 18,582,767	M313T	probably benign	Het
Zp3r	G	A	1: 130,583,480	S387F	probably benign	Het

Other mutations in Lcp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Lcp1	APN	14	75227093	critical splice donor site	probably null
IGL01768:Lcp1	APN	14	75224133	missense	probably benign	0.40
IGL01801:Lcp1	APN	14	75199375	missense	probably benign	0.10
IGL01940:Lcp1	APN	14	75216365	missense	probably benign	0.17
IGL02135:Lcp1	APN	14	75200486	missense	probably benign	0.00
IGL02185:Lcp1	APN	14	75229300	missense	possibly damaging	0.73
IGL02478:Lcp1	APN	14	75224096	missense	probably benign	0.04
IGL02604:Lcp1	APN	14	75224126	missense	probably benign	0.11
R0244:Lcp1	UTSW	14	75227001	missense	possibly damaging	0.92
R0295:Lcp1	UTSW	14	75199420	missense	probably null	0.59
R0313:Lcp1	UTSW	14	75199433	missense	probably damaging	1.00
R0415:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
R0751:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R0811:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R0812:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R1200:Lcp1	UTSW	14	75229302	missense	possibly damaging	0.73
R1713:Lcp1	UTSW	14	75199444	critical splice donor site	probably null
R1915:Lcp1	UTSW	14	75199297	missense	possibly damaging	0.81
R1969:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1970:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1971:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R2045:Lcp1	UTSW	14	75200401	missense	probably benign	0.01
R2064:Lcp1	UTSW	14	75198075	critical splice acceptor site	probably null
R3949:Lcp1	UTSW	14	75206129	missense	possibly damaging	0.68
R4062:Lcp1	UTSW	14	75215180	missense	probably damaging	1.00
R4521:Lcp1	UTSW	14	75215168	missense	possibly damaging	0.94
R4811:Lcp1	UTSW	14	75200408	missense	probably damaging	0.99
R4854:Lcp1	UTSW	14	75200489	missense	probably damaging	1.00
R4974:Lcp1	UTSW	14	75208471	nonsense	probably null
R5539:Lcp1	UTSW	14	75229298	missense	probably benign	0.08
R5561:Lcp1	UTSW	14	75212508	missense	probably benign	0.01
R5724:Lcp1	UTSW	14	75226982	missense	probably benign	0.18
R5989:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R6731:Lcp1	UTSW	14	75206189	missense	probably damaging	1.00
R7670:Lcp1	UTSW	14	75200431	missense	probably benign	0.12
R7698:Lcp1	UTSW	14	75206211	nonsense	probably null
R9780:Lcp1	UTSW	14	75202738	missense	probably damaging	1.00
S24628:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
X0027:Lcp1	UTSW	14	75227086	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTTCTAGTTGAGTGAATGTGTC -3'
(R):5'- TGCTACATGGCACTACATTGG -3'

Sequencing Primer
(F):5'- AATGTGTCTAGGTCAGTTAATTGC -3'
(R):5'- GGCACTACATTGGCATCTATTTC -3'

Posted On

2019-09-13