Incidental Mutation 'R7346:Nipbl'
ID570229
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene NameNIPBL cohesin loading factor
Synonyms4921518A06Rik, 4933421G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7346 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location8290617-8444463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8343606 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1052 (E1052G)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052965
AA Change: E1052G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: E1052G

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 56,007,303 P52S unknown Het
Adarb2 A G 13: 8,570,384 E302G probably damaging Het
Adgrf5 T A 17: 43,451,179 L1255H probably damaging Het
Adra1a T A 14: 66,638,284 I236N probably benign Het
As3mt T C 19: 46,720,452 F295S probably damaging Het
Bmp5 G A 9: 75,873,360 R313Q probably damaging Het
Ccnj T A 19: 40,844,950 S191T probably benign Het
Clk2 T A 3: 89,173,545 probably null Het
Cpz T C 5: 35,517,656 E83G probably damaging Het
Cts3 A G 13: 61,567,620 I133T probably benign Het
Dars2 C T 1: 161,046,772 probably null Het
Dsel A T 1: 111,861,068 V579D probably damaging Het
Dync1h1 C A 12: 110,635,642 A2038E probably damaging Het
Eaf1 A G 14: 31,494,820 probably benign Het
Fsip2 A C 2: 82,998,180 I6774L probably benign Het
Glis2 T C 16: 4,613,568 F320L possibly damaging Het
Hcar1 A G 5: 123,879,630 probably benign Het
Hectd1 A T 12: 51,750,321 H2211Q probably benign Het
Hmcn1 A G 1: 150,683,745 I2385T probably damaging Het
Ifi44 T A 3: 151,732,457 M398L probably benign Het
Il16 C T 7: 83,644,041 E1273K probably damaging Het
Inpp5j G A 11: 3,501,065 T528I probably damaging Het
Kbtbd6 C T 14: 79,453,187 P441S probably damaging Het
Kcnt1 C T 2: 25,863,843 probably benign Het
Kif26b T C 1: 178,530,741 L139P probably damaging Het
Klb C T 5: 65,348,631 Q74* probably null Het
L3mbtl1 G A 2: 162,967,006 V600I probably benign Het
Lcp1 C T 14: 75,210,506 A317V possibly damaging Het
Lipc C T 9: 70,812,747 G326D probably damaging Het
Mbnl2 T A 14: 120,379,282 F103I probably benign Het
Mdm1 G T 10: 118,164,288 E609* probably null Het
Med16 A G 10: 79,908,816 probably null Het
Mga T C 2: 119,935,527 V1424A possibly damaging Het
Mocs2 G T 13: 114,828,174 probably null Het
Morc1 C T 16: 48,630,900 probably null Het
Mpc2 T A 1: 165,479,511 W94R probably damaging Het
Mrm3 G A 11: 76,250,176 V337I possibly damaging Het
N4bp3 T C 11: 51,645,606 H133R probably benign Het
Ncam2 G T 16: 81,623,368 G810V probably damaging Het
Nlrp12 C T 7: 3,249,257 V95M probably damaging Het
Nrip1 T C 16: 76,293,356 N438D possibly damaging Het
Nsun4 C A 4: 116,051,838 M508I probably benign Het
Pla2g2c T C 4: 138,734,339 S40P probably damaging Het
Plec A G 15: 76,197,978 probably null Het
Ppfia2 G T 10: 106,857,495 M620I possibly damaging Het
Ppp6c A G 2: 39,226,217 Y9H probably damaging Het
Prkd1 A T 12: 50,648,834 I47N possibly damaging Het
Prr14l T C 5: 32,830,684 D489G probably benign Het
Ptch2 T A 4: 117,114,652 Y1124N probably benign Het
Ptpra T G 2: 130,553,400 Y808D probably damaging Het
Rint1 T A 5: 23,815,653 F558Y possibly damaging Het
Rnf215 T A 11: 4,139,792 C268* probably null Het
Slc25a13 T C 6: 6,181,100 E28G possibly damaging Het
Slc38a8 G T 8: 119,499,815 Y78* probably null Het
Slc4a7 T C 14: 14,775,000 M810T probably damaging Het
Slitrk1 A G 14: 108,913,159 V40A possibly damaging Het
Sobp A T 10: 43,022,835 S251R probably damaging Het
Spata31d1a G A 13: 59,703,201 S371L probably benign Het
Tada2b T C 5: 36,476,836 T133A possibly damaging Het
Tbc1d20 A G 2: 152,304,961 D90G probably benign Het
Tek T A 4: 94,827,296 I408K probably benign Het
Tgfb2 A G 1: 186,649,880 F150S probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tspan17 C G 13: 54,792,621 L34V probably benign Het
Vmn1r238 A T 18: 3,123,151 Y88N probably damaging Het
Vmn1r85 A G 7: 13,085,037 I60T probably damaging Het
Vmn2r96 T C 17: 18,582,767 M313T probably benign Het
Zp3r G A 1: 130,583,480 S387F probably benign Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7958:Nipbl UTSW 15 8311258 missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8311250 missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8359212 missense probably benign 0.22
R8355:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8441:Nipbl UTSW 15 8293115 missense probably benign 0.00
R8455:Nipbl UTSW 15 8335044 missense probably damaging 0.98
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTAACTGTGCTCTTGTTAACCC -3'
(R):5'- CCTAACATGGACAAGATGCCTG -3'

Sequencing Primer
(F):5'- GTGCTCTTGTTAACCCCCAAATTATG -3'
(R):5'- CAAGATGCCTGTATCATTAATCTCGG -3'
Posted On2019-09-13