Incidental Mutation 'R7346:Nrip1'
ID570232
Institutional Source Beutler Lab
Gene Symbol Nrip1
Ensembl Gene ENSMUSG00000048490
Gene Namenuclear receptor interacting protein 1
SynonymsRIP140, 6030458L20Rik, 8430438I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7346 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location76287400-76373827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76293356 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 438 (N438D)
Ref Sequence ENSEMBL: ENSMUSP00000051726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054178] [ENSMUST00000121927] [ENSMUST00000140483] [ENSMUST00000231585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054178
AA Change: N438D

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051726
Gene: ENSMUSG00000048490
AA Change: N438D

DomainStartEndE-ValueType
low complexity region 182 195 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
PDB:2GPP|D 368 392 2e-7 PDB
low complexity region 707 718 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121927
AA Change: N438D

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112959
Gene: ENSMUSG00000048490
AA Change: N438D

DomainStartEndE-ValueType
Pfam:NRIP1_repr_1 27 331 5.4e-141 PFAM
PDB:2GPP|D 368 392 2e-7 PDB
Pfam:NRIP1_repr_2 412 739 7.5e-122 PFAM
Pfam:NRIP1_repr_3 754 841 8.4e-45 PFAM
Pfam:NRIP1_repr_4 849 1161 1.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140483
Predicted Effect probably benign
Transcript: ENSMUST00000231585
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear receptor interacting protein 1 (NRIP1) is a nuclear protein that specifically interacts with the hormone-dependent activation domain AF2 of nuclear receptors. Also known as RIP140, this protein modulates transcriptional activity of the estrogen receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for targeted disruption of this gene results in female infertility due to ovulation failure. Heterozygous females are partially affected. Male and female mice are smaller than wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 56,007,303 P52S unknown Het
Adarb2 A G 13: 8,570,384 E302G probably damaging Het
Adgrf5 T A 17: 43,451,179 L1255H probably damaging Het
Adra1a T A 14: 66,638,284 I236N probably benign Het
As3mt T C 19: 46,720,452 F295S probably damaging Het
Bmp5 G A 9: 75,873,360 R313Q probably damaging Het
Ccnj T A 19: 40,844,950 S191T probably benign Het
Clk2 T A 3: 89,173,545 probably null Het
Cpz T C 5: 35,517,656 E83G probably damaging Het
Cts3 A G 13: 61,567,620 I133T probably benign Het
Dars2 C T 1: 161,046,772 probably null Het
Dsel A T 1: 111,861,068 V579D probably damaging Het
Dync1h1 C A 12: 110,635,642 A2038E probably damaging Het
Eaf1 A G 14: 31,494,820 probably benign Het
Fsip2 A C 2: 82,998,180 I6774L probably benign Het
Glis2 T C 16: 4,613,568 F320L possibly damaging Het
Hcar1 A G 5: 123,879,630 probably benign Het
Hectd1 A T 12: 51,750,321 H2211Q probably benign Het
Hmcn1 A G 1: 150,683,745 I2385T probably damaging Het
Ifi44 T A 3: 151,732,457 M398L probably benign Het
Il16 C T 7: 83,644,041 E1273K probably damaging Het
Inpp5j G A 11: 3,501,065 T528I probably damaging Het
Kbtbd6 C T 14: 79,453,187 P441S probably damaging Het
Kcnt1 C T 2: 25,863,843 probably benign Het
Kif26b T C 1: 178,530,741 L139P probably damaging Het
Klb C T 5: 65,348,631 Q74* probably null Het
L3mbtl1 G A 2: 162,967,006 V600I probably benign Het
Lcp1 C T 14: 75,210,506 A317V possibly damaging Het
Lipc C T 9: 70,812,747 G326D probably damaging Het
Mbnl2 T A 14: 120,379,282 F103I probably benign Het
Mdm1 G T 10: 118,164,288 E609* probably null Het
Med16 A G 10: 79,908,816 probably null Het
Mga T C 2: 119,935,527 V1424A possibly damaging Het
Mocs2 G T 13: 114,828,174 probably null Het
Morc1 C T 16: 48,630,900 probably null Het
Mpc2 T A 1: 165,479,511 W94R probably damaging Het
Mrm3 G A 11: 76,250,176 V337I possibly damaging Het
N4bp3 T C 11: 51,645,606 H133R probably benign Het
Ncam2 G T 16: 81,623,368 G810V probably damaging Het
Nipbl T C 15: 8,343,606 E1052G possibly damaging Het
Nlrp12 C T 7: 3,249,257 V95M probably damaging Het
Nsun4 C A 4: 116,051,838 M508I probably benign Het
Pla2g2c T C 4: 138,734,339 S40P probably damaging Het
Plec A G 15: 76,197,978 probably null Het
Ppfia2 G T 10: 106,857,495 M620I possibly damaging Het
Ppp6c A G 2: 39,226,217 Y9H probably damaging Het
Prkd1 A T 12: 50,648,834 I47N possibly damaging Het
Prr14l T C 5: 32,830,684 D489G probably benign Het
Ptch2 T A 4: 117,114,652 Y1124N probably benign Het
Ptpra T G 2: 130,553,400 Y808D probably damaging Het
Rint1 T A 5: 23,815,653 F558Y possibly damaging Het
Rnf215 T A 11: 4,139,792 C268* probably null Het
Slc25a13 T C 6: 6,181,100 E28G possibly damaging Het
Slc38a8 G T 8: 119,499,815 Y78* probably null Het
Slc4a7 T C 14: 14,775,000 M810T probably damaging Het
Slitrk1 A G 14: 108,913,159 V40A possibly damaging Het
Sobp A T 10: 43,022,835 S251R probably damaging Het
Spata31d1a G A 13: 59,703,201 S371L probably benign Het
Tada2b T C 5: 36,476,836 T133A possibly damaging Het
Tbc1d20 A G 2: 152,304,961 D90G probably benign Het
Tek T A 4: 94,827,296 I408K probably benign Het
Tgfb2 A G 1: 186,649,880 F150S probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tspan17 C G 13: 54,792,621 L34V probably benign Het
Vmn1r238 A T 18: 3,123,151 Y88N probably damaging Het
Vmn1r85 A G 7: 13,085,037 I60T probably damaging Het
Vmn2r96 T C 17: 18,582,767 M313T probably benign Het
Zp3r G A 1: 130,583,480 S387F probably benign Het
Other mutations in Nrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nrip1 APN 16 76293703 missense possibly damaging 0.48
IGL00732:Nrip1 APN 16 76293061 missense probably benign 0.31
IGL02024:Nrip1 APN 16 76291675 missense probably benign 0.05
IGL02172:Nrip1 APN 16 76291492 missense probably damaging 0.99
IGL02432:Nrip1 APN 16 76291780 missense probably benign 0.04
IGL03025:Nrip1 APN 16 76294465 missense probably benign 0.06
IGL03410:Nrip1 APN 16 76292491 missense probably benign
PIT4802001:Nrip1 UTSW 16 76293269 missense probably damaging 0.97
R0064:Nrip1 UTSW 16 76294670 utr 5 prime probably benign
R0304:Nrip1 UTSW 16 76292707 missense possibly damaging 0.67
R0320:Nrip1 UTSW 16 76292363 missense probably benign 0.00
R0368:Nrip1 UTSW 16 76294016 missense probably damaging 0.99
R1730:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1783:Nrip1 UTSW 16 76292890 missense probably benign 0.42
R1850:Nrip1 UTSW 16 76293344 missense probably damaging 1.00
R1900:Nrip1 UTSW 16 76292039 missense probably benign
R2252:Nrip1 UTSW 16 76291285 missense probably damaging 1.00
R3935:Nrip1 UTSW 16 76294435 missense possibly damaging 0.67
R4290:Nrip1 UTSW 16 76291988 missense probably benign 0.00
R4426:Nrip1 UTSW 16 76291405 missense possibly damaging 0.87
R4598:Nrip1 UTSW 16 76293080 missense probably damaging 1.00
R4607:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R4608:Nrip1 UTSW 16 76293032 missense probably benign 0.00
R5893:Nrip1 UTSW 16 76293953 missense probably damaging 1.00
R5939:Nrip1 UTSW 16 76292122 missense probably damaging 0.99
R5966:Nrip1 UTSW 16 76293583 missense possibly damaging 0.47
R6093:Nrip1 UTSW 16 76294764 start gained probably benign
R6154:Nrip1 UTSW 16 76293830 missense probably damaging 1.00
R6639:Nrip1 UTSW 16 76293995 nonsense probably null
R6910:Nrip1 UTSW 16 76294417 missense probably damaging 1.00
R6921:Nrip1 UTSW 16 76292588 missense possibly damaging 0.88
R7314:Nrip1 UTSW 16 76291190 missense probably benign 0.00
R7386:Nrip1 UTSW 16 76293887 missense probably damaging 1.00
R7485:Nrip1 UTSW 16 76291450 missense probably damaging 1.00
R7506:Nrip1 UTSW 16 76294459 missense probably damaging 1.00
R7517:Nrip1 UTSW 16 76291184 makesense probably null
R7657:Nrip1 UTSW 16 76294699 splice site probably null
R7878:Nrip1 UTSW 16 76294666 start codon destroyed probably null 0.99
R8068:Nrip1 UTSW 16 76292953 missense possibly damaging 0.62
R8254:Nrip1 UTSW 16 76291399 missense probably benign 0.02
R8261:Nrip1 UTSW 16 76292061 missense possibly damaging 0.69
R8294:Nrip1 UTSW 16 76292530 missense probably damaging 1.00
Z1177:Nrip1 UTSW 16 76293479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGGCCGAGCAGCAACTG -3'
(R):5'- GCTGCTAATAACAGTCTGCTTTTG -3'

Sequencing Primer
(F):5'- CAACTGAAGAAGAGTGACTTTCTG -3'
(R):5'- TTTGCATCTCCTCAAAAGCCAG -3'
Posted On2019-09-13