Incidental Mutation 'R7347:Olfr1208'
ID570253
Institutional Source Beutler Lab
Gene Symbol Olfr1208
Ensembl Gene ENSMUSG00000075114
Gene Nameolfactory receptor 1208
SynonymsMOR225-4, GA_x6K02T2Q125-50372411-50371485
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7347 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88895575-88902311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88897271 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 109 (I109V)
Ref Sequence ENSEMBL: ENSMUSP00000149280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099810] [ENSMUST00000214121] [ENSMUST00000214297]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099810
AA Change: I109V

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097398
Gene: ENSMUSG00000075114
AA Change: I109V

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.9e-48 PFAM
Pfam:7tm_1 38 284 2.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214121
AA Change: I109V

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214297
AA Change: I109V

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,282,646 E22V possibly damaging Het
4930564D02Rik G T 3: 105,078,412 R47S unknown Het
4931408C20Rik A T 1: 26,684,467 L544Q probably benign Het
Abtb2 T G 2: 103,567,412 I229S probably damaging Het
Adgre1 T C 17: 57,420,441 L457P probably damaging Het
Amer3 C A 1: 34,587,902 D407E probably damaging Het
Arhgap20 T C 9: 51,849,035 S729P probably benign Het
Asap2 T G 12: 21,229,457 I418S probably benign Het
Atp5j2 T C 5: 145,188,485 probably null Het
Brinp3 T A 1: 146,902,086 V757E probably benign Het
Brip1 C T 11: 86,139,103 G572R probably benign Het
C3 C A 17: 57,223,215 R462L probably benign Het
Cat T A 2: 103,463,298 H395L probably benign Het
Cela3a T C 4: 137,402,606 N235D possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cntnap1 G T 11: 101,185,268 G993W probably damaging Het
Col9a1 A G 1: 24,179,403 probably null Het
Coro2b G T 9: 62,489,372 H29N probably benign Het
Dll3 C T 7: 28,299,111 R143H probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 *114R probably null Het
Ecm2 T C 13: 49,515,078 S86P probably damaging Het
Eif5 T C 12: 111,540,290 probably benign Het
Ets1 T A 9: 32,733,032 probably null Het
Exph5 A G 9: 53,375,896 N1426D possibly damaging Het
Eya2 T C 2: 165,687,666 F110L probably benign Het
Flt1 T A 5: 147,580,381 E1032V probably damaging Het
Galnt5 A T 2: 58,017,193 H556L probably benign Het
Glb1l3 A T 9: 26,829,003 Y344N probably benign Het
Glrx3 C A 7: 137,459,286 D216E possibly damaging Het
Gm45871 T A 18: 90,591,375 C246S probably damaging Het
Gm8251 G T 1: 44,059,496 P814Q probably damaging Het
Gm906 T C 13: 50,245,744 I849V probably benign Het
Gstm4 A G 3: 108,042,373 L137P probably benign Het
Hsd17b13 T C 5: 103,968,750 T169A probably damaging Het
Hydin A C 8: 110,600,362 T4778P probably benign Het
Ifna15 A G 4: 88,557,983 L88P probably damaging Het
Kcnab1 G A 3: 65,376,531 R390H probably benign Het
Kng1 C A 16: 23,067,787 H161N possibly damaging Het
Lamp5 T C 2: 136,060,958 V199A probably benign Het
Lrig3 G A 10: 126,009,966 V755M probably damaging Het
Mad1l1 C T 5: 140,144,044 R412H probably damaging Het
March6 C A 15: 31,486,359 C350F probably benign Het
Mastl A G 2: 23,133,389 S441P probably damaging Het
Mfsd13b A T 7: 120,991,728 M231L probably benign Het
Micalcl T C 7: 112,382,151 V444A probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 A G 11: 60,477,961 M516V probably benign Het
Myo1b A T 1: 51,751,254 F1110L probably damaging Het
Nbr1 T A 11: 101,569,321 L381* probably null Het
Nln T C 13: 104,050,847 K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Nrp2 C T 1: 62,745,504 P271S probably benign Het
Obox6 A C 7: 15,834,646 L102V possibly damaging Het
Olfr1008 T C 2: 85,689,837 M136T probably damaging Het
Olfr1241 T C 2: 89,482,455 S227G probably benign Het
Olfr853 A G 9: 19,537,099 M277T probably damaging Het
Pde10a A G 17: 8,967,462 H567R probably damaging Het
Pdgfra C T 5: 75,183,098 S760L possibly damaging Het
Pid1 T A 1: 84,159,129 I94L unknown Het
Plekhn1 T C 4: 156,222,671 H474R probably benign Het
Prcc A T 3: 87,869,681 S329T possibly damaging Het
Pros1 G T 16: 62,919,523 R445L probably damaging Het
Pxdn C A 12: 30,012,261 H1370Q probably benign Het
Sgce T A 6: 4,694,106 R283S probably damaging Het
Slc25a20 T G 9: 108,682,458 probably null Het
Slc6a1 T C 6: 114,311,818 V446A probably damaging Het
Slc6a4 C G 11: 77,017,085 Y358* probably null Het
Sned1 A C 1: 93,281,736 E857A probably damaging Het
Spdye4b C T 5: 143,202,390 R213C possibly damaging Het
Spry2 T G 14: 105,893,512 E80A probably damaging Het
Stard9 G A 2: 120,666,534 C142Y probably benign Het
Sync A T 4: 129,294,306 Q377L probably benign Het
Tdrd12 A G 7: 35,485,692 C718R Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmbim1 T C 1: 74,291,279 E185G probably benign Het
Tyk2 T C 9: 21,108,034 M1031V probably damaging Het
Vmn1r71 C T 7: 10,748,501 V87I not run Het
Vmn2r49 A G 7: 9,986,814 V250A probably benign Het
Yipf3 A C 17: 46,250,827 T187P probably damaging Het
Zfp148 G T 16: 33,434,790 R50L possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Olfr1208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Olfr1208 APN 2 88896977 missense probably damaging 1.00
IGL02132:Olfr1208 APN 2 88897159 missense probably benign
IGL02374:Olfr1208 APN 2 88897459 missense probably damaging 1.00
R1378:Olfr1208 UTSW 2 88897026 missense probably benign 0.01
R1570:Olfr1208 UTSW 2 88896946 missense probably damaging 1.00
R2056:Olfr1208 UTSW 2 88896761 missense probably damaging 1.00
R2092:Olfr1208 UTSW 2 88897267 missense probably damaging 0.99
R2185:Olfr1208 UTSW 2 88896703 missense probably damaging 0.99
R5223:Olfr1208 UTSW 2 88897334 missense probably benign 0.03
R5479:Olfr1208 UTSW 2 88896691 missense probably benign 0.13
R6463:Olfr1208 UTSW 2 88897118 missense probably benign 0.00
R6859:Olfr1208 UTSW 2 88896934 missense probably benign
R7352:Olfr1208 UTSW 2 88896718 missense probably damaging 1.00
R7544:Olfr1208 UTSW 2 88897361 missense probably damaging 1.00
R7713:Olfr1208 UTSW 2 88897778 start gained probably benign
R7842:Olfr1208 UTSW 2 88896961 missense possibly damaging 0.89
R7869:Olfr1208 UTSW 2 88897064 missense probably benign 0.00
R8137:Olfr1208 UTSW 2 88896669 makesense probably null
R8168:Olfr1208 UTSW 2 88896776 missense probably benign 0.09
Z1176:Olfr1208 UTSW 2 88897061 missense probably damaging 1.00
Z1177:Olfr1208 UTSW 2 88896800 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCCACAAAAGGGAAGTCTG -3'
(R):5'- ATTCTCTGTGGAAACCTGGTTG -3'

Sequencing Primer
(F):5'- GTCTGATAATAACCAGTACATGCAC -3'
(R):5'- CTATCAAGGGCAGTCAACTTAGTG -3'
Posted On2019-09-13