Incidental Mutation 'R7347:Kcnab1'
ID570260
Institutional Source Beutler Lab
Gene Symbol Kcnab1
Ensembl Gene ENSMUSG00000027827
Gene Namepotassium voltage-gated channel, shaker-related subfamily, beta member 1
SynonymsKvbeta1.1, mKv(beta)1, Akr8a8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7347 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location65109384-65378223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65376531 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 390 (R390H)
Ref Sequence ENSEMBL: ENSMUSP00000047480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029414] [ENSMUST00000049230]
Predicted Effect probably benign
Transcript: ENSMUST00000029414
SMART Domains Protein: ENSMUSP00000029414
Gene: ENSMUSG00000027828

DomainStartEndE-ValueType
Pfam:TRAP-gamma 12 183 5.6e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049230
AA Change: R390H

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827
AA Change: R390H

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 85 390 1.8e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,282,646 E22V possibly damaging Het
4930564D02Rik G T 3: 105,078,412 R47S unknown Het
4931408C20Rik A T 1: 26,684,467 L544Q probably benign Het
Abtb2 T G 2: 103,567,412 I229S probably damaging Het
Adgre1 T C 17: 57,420,441 L457P probably damaging Het
Amer3 C A 1: 34,587,902 D407E probably damaging Het
Arhgap20 T C 9: 51,849,035 S729P probably benign Het
Asap2 T G 12: 21,229,457 I418S probably benign Het
Atp5j2 T C 5: 145,188,485 probably null Het
Brinp3 T A 1: 146,902,086 V757E probably benign Het
Brip1 C T 11: 86,139,103 G572R probably benign Het
C3 C A 17: 57,223,215 R462L probably benign Het
Cat T A 2: 103,463,298 H395L probably benign Het
Cela3a T C 4: 137,402,606 N235D possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cntnap1 G T 11: 101,185,268 G993W probably damaging Het
Col9a1 A G 1: 24,179,403 probably null Het
Coro2b G T 9: 62,489,372 H29N probably benign Het
Dll3 C T 7: 28,299,111 R143H probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 *114R probably null Het
Ecm2 T C 13: 49,515,078 S86P probably damaging Het
Eif5 T C 12: 111,540,290 probably benign Het
Ets1 T A 9: 32,733,032 probably null Het
Exph5 A G 9: 53,375,896 N1426D possibly damaging Het
Eya2 T C 2: 165,687,666 F110L probably benign Het
Flt1 T A 5: 147,580,381 E1032V probably damaging Het
Galnt5 A T 2: 58,017,193 H556L probably benign Het
Glb1l3 A T 9: 26,829,003 Y344N probably benign Het
Glrx3 C A 7: 137,459,286 D216E possibly damaging Het
Gm45871 T A 18: 90,591,375 C246S probably damaging Het
Gm8251 G T 1: 44,059,496 P814Q probably damaging Het
Gm906 T C 13: 50,245,744 I849V probably benign Het
Gstm4 A G 3: 108,042,373 L137P probably benign Het
Hsd17b13 T C 5: 103,968,750 T169A probably damaging Het
Hydin A C 8: 110,600,362 T4778P probably benign Het
Ifna15 A G 4: 88,557,983 L88P probably damaging Het
Kng1 C A 16: 23,067,787 H161N possibly damaging Het
Lamp5 T C 2: 136,060,958 V199A probably benign Het
Lrig3 G A 10: 126,009,966 V755M probably damaging Het
Mad1l1 C T 5: 140,144,044 R412H probably damaging Het
March6 C A 15: 31,486,359 C350F probably benign Het
Mastl A G 2: 23,133,389 S441P probably damaging Het
Mfsd13b A T 7: 120,991,728 M231L probably benign Het
Micalcl T C 7: 112,382,151 V444A probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 A G 11: 60,477,961 M516V probably benign Het
Myo1b A T 1: 51,751,254 F1110L probably damaging Het
Nbr1 T A 11: 101,569,321 L381* probably null Het
Nln T C 13: 104,050,847 K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Nrp2 C T 1: 62,745,504 P271S probably benign Het
Obox6 A C 7: 15,834,646 L102V possibly damaging Het
Olfr1008 T C 2: 85,689,837 M136T probably damaging Het
Olfr1208 T C 2: 88,897,271 I109V possibly damaging Het
Olfr1241 T C 2: 89,482,455 S227G probably benign Het
Olfr853 A G 9: 19,537,099 M277T probably damaging Het
Pde10a A G 17: 8,967,462 H567R probably damaging Het
Pdgfra C T 5: 75,183,098 S760L possibly damaging Het
Pid1 T A 1: 84,159,129 I94L unknown Het
Plekhn1 T C 4: 156,222,671 H474R probably benign Het
Prcc A T 3: 87,869,681 S329T possibly damaging Het
Pros1 G T 16: 62,919,523 R445L probably damaging Het
Pxdn C A 12: 30,012,261 H1370Q probably benign Het
Sgce T A 6: 4,694,106 R283S probably damaging Het
Slc25a20 T G 9: 108,682,458 probably null Het
Slc6a1 T C 6: 114,311,818 V446A probably damaging Het
Slc6a4 C G 11: 77,017,085 Y358* probably null Het
Sned1 A C 1: 93,281,736 E857A probably damaging Het
Spdye4b C T 5: 143,202,390 R213C possibly damaging Het
Spry2 T G 14: 105,893,512 E80A probably damaging Het
Stard9 G A 2: 120,666,534 C142Y probably benign Het
Sync A T 4: 129,294,306 Q377L probably benign Het
Tdrd12 A G 7: 35,485,692 C718R Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmbim1 T C 1: 74,291,279 E185G probably benign Het
Tyk2 T C 9: 21,108,034 M1031V probably damaging Het
Vmn1r71 C T 7: 10,748,501 V87I not run Het
Vmn2r49 A G 7: 9,986,814 V250A probably benign Het
Yipf3 A C 17: 46,250,827 T187P probably damaging Het
Zfp148 G T 16: 33,434,790 R50L possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Kcnab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Kcnab1 APN 3 65319454 missense probably damaging 1.00
IGL01936:Kcnab1 APN 3 65358274 missense probably damaging 1.00
IGL02291:Kcnab1 APN 3 65357082 missense possibly damaging 0.94
IGL02425:Kcnab1 APN 3 65302179 missense possibly damaging 0.59
PIT4418001:Kcnab1 UTSW 3 65358320 missense probably benign 0.12
R0017:Kcnab1 UTSW 3 65357106 missense probably damaging 0.98
R0017:Kcnab1 UTSW 3 65357106 missense probably damaging 0.98
R0811:Kcnab1 UTSW 3 65297720 missense probably damaging 1.00
R0812:Kcnab1 UTSW 3 65297720 missense probably damaging 1.00
R1847:Kcnab1 UTSW 3 65302194 critical splice donor site probably null
R1926:Kcnab1 UTSW 3 65376512 missense possibly damaging 0.73
R2064:Kcnab1 UTSW 3 65364639 missense probably benign 0.07
R2152:Kcnab1 UTSW 3 65371440 missense probably damaging 0.99
R2153:Kcnab1 UTSW 3 65371440 missense probably damaging 0.99
R2197:Kcnab1 UTSW 3 65109947 missense probably benign 0.00
R2233:Kcnab1 UTSW 3 65319467 missense probably damaging 1.00
R2235:Kcnab1 UTSW 3 65319467 missense probably damaging 1.00
R2437:Kcnab1 UTSW 3 65357014 splice site probably benign
R3916:Kcnab1 UTSW 3 65304164 critical splice donor site probably null
R4093:Kcnab1 UTSW 3 65299614 missense possibly damaging 0.96
R4347:Kcnab1 UTSW 3 65297475 intron probably benign
R4796:Kcnab1 UTSW 3 65304165 critical splice donor site probably null
R5588:Kcnab1 UTSW 3 65376555 missense possibly damaging 0.59
R7254:Kcnab1 UTSW 3 65319487 missense probably benign 0.08
R7424:Kcnab1 UTSW 3 65266503 missense possibly damaging 0.80
Z1177:Kcnab1 UTSW 3 65266510 missense probably damaging 0.99
Z1177:Kcnab1 UTSW 3 65357133 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGACTTGAAGCTTATCCATTGTGG -3'
(R):5'- CACAGTGGTAGCAACAGCAG -3'

Sequencing Primer
(F):5'- AAGCTTATCCATTGTGGGGCATG -3'
(R):5'- GAAACCTCAGAGAATCCTGGGAC -3'
Posted On2019-09-13