Mutagenetix > Incidental Mutations

Incidental Mutation 'R0645:Cep350'

57027

Institutional Source

Beutler Lab

Gene Symbol

Cep350

Ensembl Gene

ENSMUSG00000033671

Gene Name

centrosomal protein 350

Synonyms

6430546F08Rik, 4933409L06Rik

MMRRC Submission

038830-MU

Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R0645 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

155844964-155973255 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 155940712 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]

Predicted Effect

probably null
Transcript: ENSMUST00000124495

Predicted Effect

probably null
Transcript: ENSMUST00000138762

SMART Domains

Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671

Domain	Start	End	E-Value	Type
low complexity region	251	265	N/A	INTRINSIC
low complexity region	376	394	N/A	INTRINSIC
low complexity region	481	491	N/A	INTRINSIC
coiled coil region	596	641	N/A	INTRINSIC
low complexity region	659	669	N/A	INTRINSIC
low complexity region	701	719	N/A	INTRINSIC
low complexity region	754	763	N/A	INTRINSIC
low complexity region	979	994	N/A	INTRINSIC
low complexity region	1153	1175	N/A	INTRINSIC
low complexity region	1250	1267	N/A	INTRINSIC
coiled coil region	1363	1402	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1536	1546	N/A	INTRINSIC
low complexity region	1694	1714	N/A	INTRINSIC
coiled coil region	1732	1794	N/A	INTRINSIC
low complexity region	1800	1811	N/A	INTRINSIC
low complexity region	1819	1835	N/A	INTRINSIC
coiled coil region	1853	1893	N/A	INTRINSIC
low complexity region	1980	1994	N/A	INTRINSIC
coiled coil region	2042	2092	N/A	INTRINSIC
low complexity region	2383	2394	N/A	INTRINSIC
low complexity region	2409	2421	N/A	INTRINSIC
low complexity region	2470	2482	N/A	INTRINSIC
CAP_GLY	2486	2551	5.91e-31	SMART
coiled coil region	2700	2731	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

99% (94/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	C	T	2: 111,214,583		probably null	Het
Adam18	G	T	8: 24,672,120	Y46*	probably null	Het
Adam26b	A	C	8: 43,520,487	C493G	probably damaging	Het
Ak5	A	T	3: 152,653,615	L182Q	probably damaging	Het
Akt1s1	T	C	7: 44,849,221		probably benign	Het
Amhr2	G	T	15: 102,446,428	G133C	probably damaging	Het
Btbd9	A	T	17: 30,524,967	L187Q	probably damaging	Het
Ccdc117	A	T	11: 5,534,385		probably benign	Het
Ccdc138	A	T	10: 58,575,720	I637F	probably damaging	Het
Ccdc162	A	G	10: 41,586,411		probably benign	Het
Cdc25b	C	A	2: 131,191,613	H157Q	probably benign	Het
Cdon	A	G	9: 35,477,083		probably null	Het
Cdt1	G	A	8: 122,572,145		probably benign	Het
Cfb	T	C	17: 34,860,016	K831R	probably benign	Het
Cldn4	C	A	5: 134,946,791		probably benign	Het
Cntnap5b	T	C	1: 100,072,042		probably benign	Het
Cyp27b1	T	G	10: 127,049,098	S77A	probably benign	Het
Dlc1	T	C	8: 36,574,049	D1342G	possibly damaging	Het
Dlgap4	A	G	2: 156,761,879	H887R	probably damaging	Het
Duox2	A	G	2: 122,292,658	I503T	probably damaging	Het
Elmsan1	G	T	12: 84,158,303	N834K	possibly damaging	Het
Eml4	T	C	17: 83,463,493		probably benign	Het
Ermap	A	G	4: 119,185,691	S212P	probably benign	Het
Esrrg	T	A	1: 188,043,341	C22S	probably benign	Het
Evx2	T	A	2: 74,657,894	Y194F	possibly damaging	Het
Fam126a	C	T	5: 23,979,508	G242D	probably damaging	Het
Fbn2	T	G	18: 58,058,389	D1554A	probably damaging	Het
Flrt1	G	A	19: 7,097,143		probably benign	Het
Fndc5	A	G	4: 129,139,837		probably benign	Het
Frem1	A	T	4: 82,989,166	I837N	probably damaging	Het
Fzd10	G	T	5: 128,602,598	A461S	possibly damaging	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gbp7	A	G	3: 142,538,165		probably null	Het
Gm10639	T	C	9: 78,299,021	I75T	possibly damaging	Het
Gm5919	T	A	9: 83,883,383	C91S	unknown	Het
Gm597	T	A	1: 28,776,930	N674Y	probably damaging	Het
Gpr31b	A	T	17: 13,052,206	C25*	probably null	Het
Grb10	A	G	11: 11,936,755	S505P	probably damaging	Het
Grm4	A	T	17: 27,435,209	V542E	probably damaging	Het
Hivep3	G	A	4: 120,097,334	R949H	possibly damaging	Het
Invs	A	T	4: 48,407,653	M543L	probably benign	Het
Kcnk2	T	C	1: 189,256,730		probably null	Het
Kdm6b	A	T	11: 69,405,018	S808T	unknown	Het
Klhl30	C	T	1: 91,355,506	R277W	probably damaging	Het
Lama1	A	G	17: 67,773,712	Q1245R	probably benign	Het
Lingo3	G	T	10: 80,835,335	H254N	probably benign	Het
Lzts1	A	T	8: 69,135,740	H521Q	possibly damaging	Het
Map3k19	A	C	1: 127,822,182	I1144S	possibly damaging	Het
Mast2	A	G	4: 116,307,987	S1411P	probably damaging	Het
Mast2	T	C	4: 116,312,846		probably benign	Het
Mesp1	G	T	7: 79,792,580	S225R	possibly damaging	Het
Micu1	A	G	10: 59,839,681	T366A	possibly damaging	Het
Mknk2	T	C	10: 80,671,908		probably null	Het
Msh5	A	G	17: 35,039,223	L309P	probably damaging	Het
Myo7b	T	C	18: 31,994,909	I577V	probably benign	Het
Myom2	T	A	8: 15,117,698	D1094E	probably damaging	Het
Nedd1	T	C	10: 92,691,831		probably null	Het
Neu4	T	C	1: 94,022,469	L50S	probably damaging	Het
Noa1	T	C	5: 77,309,875	Y61C	probably benign	Het
Nr1h4	A	T	10: 89,506,528	M30K	probably benign	Het
Nsd3	A	G	8: 25,709,069	I1219V	probably benign	Het
Nup188	T	A	2: 30,343,466		probably null	Het
Olfr1039	A	G	2: 86,131,034	S210P	probably damaging	Het
Olfr1123	T	A	2: 87,418,268	Y71*	probably null	Het
Olfr420	A	T	1: 174,159,354	T194S	probably benign	Het
Olfr784	T	A	10: 129,388,293	I220N	possibly damaging	Het
Pbk	G	A	14: 65,813,796		probably benign	Het
Pcnx2	G	A	8: 125,760,720	T1848M	possibly damaging	Het
Pdzd7	C	T	19: 45,045,475	G57R	possibly damaging	Het
Pik3r4	C	A	9: 105,669,187		probably benign	Het
Plce1	A	G	19: 38,777,989	S2153G	probably damaging	Het
Pphln1	G	A	15: 93,420,311	V34M	possibly damaging	Het
Prrc2a	T	C	17: 35,156,332	D1114G	probably damaging	Het
Prss16	T	C	13: 22,009,376		probably benign	Het
Rtp3	T	C	9: 110,987,100	K128E	probably damaging	Het
Scn3a	T	A	2: 65,524,850	I241F	possibly damaging	Het
Setd1a	G	A	7: 127,787,210	V336I	probably damaging	Het
Sfpq	A	G	4: 127,022,969	I320V	possibly damaging	Het
Skint5	A	T	4: 113,763,482	D678E	unknown	Het
Slc12a9	G	A	5: 137,315,376	P774S	probably benign	Het
Slc25a54	C	G	3: 109,112,165	L362V	possibly damaging	Het
Smarcd1	A	G	15: 99,707,386		probably null	Het
Suco	A	T	1: 161,834,114	M916K	probably damaging	Het
Tiam2	T	C	17: 3,514,698	S1404P	possibly damaging	Het
Topors	T	C	4: 40,260,333	T984A	unknown	Het
Trabd2b	A	T	4: 114,586,570	K308M	probably damaging	Het
Trmo	A	T	4: 46,377,083		probably benign	Het
Trpc3	A	T	3: 36,671,505	D107E	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Uggt2	A	C	14: 119,057,598	Y539D	probably benign	Het
Wwc2	T	G	8: 47,900,639		probably benign	Het
Zdbf2	T	A	1: 63,304,950	D829E	possibly damaging	Het

Other mutations in Cep350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Cep350	APN	1	155940746	missense	possibly damaging	0.68
IGL00821:Cep350	APN	1	155862204	missense	probably benign
IGL00837:Cep350	APN	1	155953391	missense	probably damaging	1.00
IGL00977:Cep350	APN	1	155932865	missense	probably null	0.99
IGL01544:Cep350	APN	1	155953187	missense	probably damaging	1.00
IGL01616:Cep350	APN	1	155953247	missense	probably benign	0.00
IGL01695:Cep350	APN	1	155944158	missense	probably damaging	1.00
IGL01902:Cep350	APN	1	155861985	missense	probably damaging	1.00
IGL01977:Cep350	APN	1	155911968	missense	probably benign	0.01
IGL02388:Cep350	APN	1	155953753	missense	probably benign	0.28
IGL02475:Cep350	APN	1	155862595	missense	probably damaging	1.00
IGL02528:Cep350	APN	1	155894615	missense	probably damaging	1.00
IGL02598:Cep350	APN	1	155862967	missense	probably benign	0.00
IGL02676:Cep350	APN	1	155862231	missense	possibly damaging	0.82
IGL02728:Cep350	APN	1	155953222	missense	probably benign	0.02
IGL02744:Cep350	APN	1	155931533	missense	probably damaging	0.98
IGL02817:Cep350	APN	1	155928842	missense	probably damaging	1.00
IGL02892:Cep350	APN	1	155868806	missense	possibly damaging	0.51
IGL03156:Cep350	APN	1	155858042	missense	probably damaging	1.00
IGL03166:Cep350	APN	1	155863600	missense	possibly damaging	0.78
IGL03216:Cep350	APN	1	155860627	missense	probably benign	0.06
IGL03268:Cep350	APN	1	155953549	missense	probably benign	0.16
IGL03358:Cep350	APN	1	155928539	missense	probably benign
NA:Cep350	UTSW	1	155958648	missense	probably damaging	1.00
R0060:Cep350	UTSW	1	155928626	missense	probably damaging	1.00
R0060:Cep350	UTSW	1	155928626	missense	probably damaging	1.00
R0066:Cep350	UTSW	1	155911218	missense	probably damaging	0.99
R0066:Cep350	UTSW	1	155911218	missense	probably damaging	0.99
R0172:Cep350	UTSW	1	155953447	missense	probably benign	0.00
R0365:Cep350	UTSW	1	155906571	missense	probably benign	0.00
R0472:Cep350	UTSW	1	155914723	missense	probably damaging	0.99
R0502:Cep350	UTSW	1	155900883	splice site	probably null
R0538:Cep350	UTSW	1	155848620	missense	possibly damaging	0.80
R0547:Cep350	UTSW	1	155901435	splice site	probably null
R0565:Cep350	UTSW	1	155961195	splice site	probably benign
R0607:Cep350	UTSW	1	155872048	missense	probably damaging	1.00
R0675:Cep350	UTSW	1	155959753	missense	possibly damaging	0.63
R0828:Cep350	UTSW	1	155953246	missense	probably benign	0.00
R0863:Cep350	UTSW	1	155862235	missense	probably benign	0.00
R0969:Cep350	UTSW	1	155940826	missense	possibly damaging	0.81
R1102:Cep350	UTSW	1	155931518	missense	probably damaging	1.00
R1186:Cep350	UTSW	1	155875376	missense	probably damaging	1.00
R1552:Cep350	UTSW	1	155910738	missense	possibly damaging	0.92
R1560:Cep350	UTSW	1	155929079	missense	possibly damaging	0.48
R1698:Cep350	UTSW	1	155953358	missense	possibly damaging	0.62
R1729:Cep350	UTSW	1	155911981	missense	probably benign	0.17
R1735:Cep350	UTSW	1	155953214	missense	probably damaging	0.99
R1740:Cep350	UTSW	1	155928833	missense	probably damaging	1.00
R1783:Cep350	UTSW	1	155928865	missense	probably damaging	1.00
R1844:Cep350	UTSW	1	155848628	missense	probably damaging	0.99
R1848:Cep350	UTSW	1	155953651	missense	probably benign	0.28
R1988:Cep350	UTSW	1	155933104	missense	possibly damaging	0.82
R2008:Cep350	UTSW	1	155914721	missense	probably benign	0.16
R2241:Cep350	UTSW	1	155958556	splice site	probably null
R2245:Cep350	UTSW	1	155879020	missense	probably benign	0.10
R2402:Cep350	UTSW	1	155863136	missense	probably benign
R2566:Cep350	UTSW	1	155959718	critical splice donor site	probably null
R3160:Cep350	UTSW	1	155863164	missense	probably benign	0.00
R3162:Cep350	UTSW	1	155863164	missense	probably benign	0.00
R3769:Cep350	UTSW	1	155953204	missense	probably damaging	1.00
R4035:Cep350	UTSW	1	155959795	missense	probably benign	0.06
R4158:Cep350	UTSW	1	155932875	missense	probably damaging	1.00
R4160:Cep350	UTSW	1	155932875	missense	probably damaging	1.00
R4213:Cep350	UTSW	1	155935961	missense	probably damaging	1.00
R4483:Cep350	UTSW	1	155926468	missense	probably benign	0.01
R4648:Cep350	UTSW	1	155902598	missense	possibly damaging	0.85
R4694:Cep350	UTSW	1	155928586	missense	probably damaging	1.00
R4836:Cep350	UTSW	1	155928833	missense	probably damaging	1.00
R4839:Cep350	UTSW	1	155928494	missense	probably benign	0.00
R4969:Cep350	UTSW	1	155860279	missense	probably damaging	0.99
R5014:Cep350	UTSW	1	155928206	missense	probably benign	0.00
R5027:Cep350	UTSW	1	155933354	missense	probably benign	0.01
R5144:Cep350	UTSW	1	155911150	missense	probably damaging	0.99
R5153:Cep350	UTSW	1	155935946	missense	probably damaging	1.00
R5165:Cep350	UTSW	1	155928368	missense	probably damaging	1.00
R5182:Cep350	UTSW	1	155858108	missense	probably damaging	1.00
R5445:Cep350	UTSW	1	155894723	missense	probably benign	0.01
R5738:Cep350	UTSW	1	155866078	missense	probably damaging	1.00
R5809:Cep350	UTSW	1	155933341	missense	probably damaging	0.98
R5855:Cep350	UTSW	1	155953762	missense	probably benign	0.00
R6103:Cep350	UTSW	1	155924576	missense	probably benign	0.05
R6139:Cep350	UTSW	1	155953279	missense	probably benign	0.03
R6285:Cep350	UTSW	1	155953374	missense	possibly damaging	0.48
R6430:Cep350	UTSW	1	155894673	missense	probably damaging	1.00
R6446:Cep350	UTSW	1	155862154	missense	probably benign
R6520:Cep350	UTSW	1	155933336	missense	probably benign	0.02
R6712:Cep350	UTSW	1	155858106	missense	possibly damaging	0.93
R6940:Cep350	UTSW	1	155928551	missense	probably benign	0.01
R7020:Cep350	UTSW	1	155928331	missense	probably damaging	1.00
R7056:Cep350	UTSW	1	155848627	missense	probably damaging	1.00
R7141:Cep350	UTSW	1	155914748	missense	probably damaging	1.00
R7215:Cep350	UTSW	1	155894707	missense	possibly damaging	0.89
R7247:Cep350	UTSW	1	155910753	missense	probably damaging	1.00
R7272:Cep350	UTSW	1	155953588	missense	probably damaging	0.98
R7336:Cep350	UTSW	1	155862276	missense	probably benign	0.17
R7361:Cep350	UTSW	1	155901491	missense	probably damaging	1.00
R7390:Cep350	UTSW	1	155866087	missense	possibly damaging	0.94
R7402:Cep350	UTSW	1	155928215	missense	probably benign	0.00
R7428:Cep350	UTSW	1	155894619	missense	probably benign	0.00
R7440:Cep350	UTSW	1	155940772	missense	probably damaging	0.98
R7520:Cep350	UTSW	1	155915629	missense	probably benign	0.05
R7529:Cep350	UTSW	1	155861923	missense	probably benign	0.08
R7635:Cep350	UTSW	1	155879021	nonsense	probably null
R7806:Cep350	UTSW	1	155862063	missense	probably benign	0.00
RF020:Cep350	UTSW	1	155915478	missense	probably benign	0.34
X0018:Cep350	UTSW	1	155953286	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ACTGGCAAGAAGACTGACATTCTGATG -3'
(R):5'- GGTGCTAAATGGGAGTCTAATGGTGG -3'

Sequencing Primer
(F):5'- tgagtgagaaggagaaagtgag -3'
(R):5'- GGCTGTCCATATTTATGCATTTCAG -3'

Posted On

2013-07-11