Incidental Mutation 'R7347:Flt1'
ID 570273
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene Name FMS-like tyrosine kinase 1
Synonyms Flt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7347 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 147561604-147726011 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 147580381 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 1032 (E1032V)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031653
AA Change: E1032V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: E1032V

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,282,646 E22V possibly damaging Het
4930564D02Rik G T 3: 105,078,412 R47S unknown Het
4931408C20Rik A T 1: 26,684,467 L544Q probably benign Het
Abtb2 T G 2: 103,567,412 I229S probably damaging Het
Adgre1 T C 17: 57,420,441 L457P probably damaging Het
Amer3 C A 1: 34,587,902 D407E probably damaging Het
Arhgap20 T C 9: 51,849,035 S729P probably benign Het
Asap2 T G 12: 21,229,457 I418S probably benign Het
Atp5j2 T C 5: 145,188,485 probably null Het
Brinp3 T A 1: 146,902,086 V757E probably benign Het
Brip1 C T 11: 86,139,103 G572R probably benign Het
C3 C A 17: 57,223,215 R462L probably benign Het
Cat T A 2: 103,463,298 H395L probably benign Het
Cela3a T C 4: 137,402,606 N235D possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cntnap1 G T 11: 101,185,268 G993W probably damaging Het
Col9a1 A G 1: 24,179,403 probably null Het
Coro2b G T 9: 62,489,372 H29N probably benign Het
Dll3 C T 7: 28,299,111 R143H probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 *114R probably null Het
Ecm2 T C 13: 49,515,078 S86P probably damaging Het
Eif5 T C 12: 111,540,290 probably benign Het
Ets1 T A 9: 32,733,032 probably null Het
Exph5 A G 9: 53,375,896 N1426D possibly damaging Het
Eya2 T C 2: 165,687,666 F110L probably benign Het
Galnt5 A T 2: 58,017,193 H556L probably benign Het
Glb1l3 A T 9: 26,829,003 Y344N probably benign Het
Glrx3 C A 7: 137,459,286 D216E possibly damaging Het
Gm45871 T A 18: 90,591,375 C246S probably damaging Het
Gm8251 G T 1: 44,059,496 P814Q probably damaging Het
Gm906 T C 13: 50,245,744 I849V probably benign Het
Gstm4 A G 3: 108,042,373 L137P probably benign Het
Hsd17b13 T C 5: 103,968,750 T169A probably damaging Het
Hydin A C 8: 110,600,362 T4778P probably benign Het
Ifna15 A G 4: 88,557,983 L88P probably damaging Het
Kcnab1 G A 3: 65,376,531 R390H probably benign Het
Kng1 C A 16: 23,067,787 H161N possibly damaging Het
Lamp5 T C 2: 136,060,958 V199A probably benign Het
Lrig3 G A 10: 126,009,966 V755M probably damaging Het
Mad1l1 C T 5: 140,144,044 R412H probably damaging Het
March6 C A 15: 31,486,359 C350F probably benign Het
Mastl A G 2: 23,133,389 S441P probably damaging Het
Mfsd13b A T 7: 120,991,728 M231L probably benign Het
Micalcl T C 7: 112,382,151 V444A probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 A G 11: 60,477,961 M516V probably benign Het
Myo1b A T 1: 51,751,254 F1110L probably damaging Het
Nbr1 T A 11: 101,569,321 L381* probably null Het
Nln T C 13: 104,050,847 K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Nrp2 C T 1: 62,745,504 P271S probably benign Het
Obox6 A C 7: 15,834,646 L102V possibly damaging Het
Olfr1008 T C 2: 85,689,837 M136T probably damaging Het
Olfr1208 T C 2: 88,897,271 I109V possibly damaging Het
Olfr1241 T C 2: 89,482,455 S227G probably benign Het
Olfr853 A G 9: 19,537,099 M277T probably damaging Het
Pde10a A G 17: 8,967,462 H567R probably damaging Het
Pdgfra C T 5: 75,183,098 S760L possibly damaging Het
Pid1 T A 1: 84,159,129 I94L unknown Het
Plekhn1 T C 4: 156,222,671 H474R probably benign Het
Prcc A T 3: 87,869,681 S329T possibly damaging Het
Pros1 G T 16: 62,919,523 R445L probably damaging Het
Pxdn C A 12: 30,012,261 H1370Q probably benign Het
Sgce T A 6: 4,694,106 R283S probably damaging Het
Slc25a20 T G 9: 108,682,458 probably null Het
Slc6a1 T C 6: 114,311,818 V446A probably damaging Het
Slc6a4 C G 11: 77,017,085 Y358* probably null Het
Sned1 A C 1: 93,281,736 E857A probably damaging Het
Spdye4b C T 5: 143,202,390 R213C possibly damaging Het
Spry2 T G 14: 105,893,512 E80A probably damaging Het
Stard9 G A 2: 120,666,534 C142Y probably benign Het
Sync A T 4: 129,294,306 Q377L probably benign Het
Tdrd12 A G 7: 35,485,692 C718R Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmbim1 T C 1: 74,291,279 E185G probably benign Het
Tyk2 T C 9: 21,108,034 M1031V probably damaging Het
Vmn1r71 C T 7: 10,748,501 V87I not run Het
Vmn2r49 A G 7: 9,986,814 V250A probably benign Het
Yipf3 A C 17: 46,250,827 T187P probably damaging Het
Zfp148 G T 16: 33,434,790 R50L possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
R8434:Flt1 UTSW 5 147639443 missense probably damaging 0.97
R8442:Flt1 UTSW 5 147576173 missense probably damaging 1.00
R8756:Flt1 UTSW 5 147639414 missense probably benign 0.07
R8855:Flt1 UTSW 5 147570872 missense probably benign 0.00
R8855:Flt1 UTSW 5 147681650 missense probably damaging 1.00
R9165:Flt1 UTSW 5 147615237 missense probably damaging 0.99
R9240:Flt1 UTSW 5 147681866 missense probably benign
R9439:Flt1 UTSW 5 147578397 missense probably damaging 1.00
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CATTTGGGGAATGACTGCTGAG -3'
(R):5'- GATGCTCCCTCTACCACAGATG -3'

Sequencing Primer
(F):5'- TGGGGAATGACTGCTGAGAAACG -3'
(R):5'- GGGAAGTGCGTTCATTAC -3'
Posted On 2019-09-13