Incidental Mutation 'R7347:Coro2b'
ID 570293
Institutional Source Beutler Lab
Gene Symbol Coro2b
Ensembl Gene ENSMUSG00000041729
Gene Name coronin, actin binding protein, 2B
Synonyms E130012P22Rik
MMRRC Submission 045374-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7347 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 62326774-62444326 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 62396654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 29 (H29N)
Ref Sequence ENSEMBL: ENSMUSP00000041826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048043] [ENSMUST00000164246] [ENSMUST00000173171]
AlphaFold Q8BH44
Predicted Effect probably benign
Transcript: ENSMUST00000048043
AA Change: H29N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041826
Gene: ENSMUSG00000041729
AA Change: H29N

DomainStartEndE-ValueType
DUF1899 10 74 2.89e-31 SMART
WD40 73 116 8.75e-5 SMART
WD40 126 166 4.95e-4 SMART
WD40 169 208 1.33e-4 SMART
WD40 211 254 2.56e1 SMART
DUF1900 261 397 1.62e-84 SMART
coiled coil region 436 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164246
AA Change: H24N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128441
Gene: ENSMUSG00000041729
AA Change: H24N

DomainStartEndE-ValueType
DUF1899 5 69 2.89e-31 SMART
WD40 68 111 8.75e-5 SMART
WD40 121 161 4.95e-4 SMART
WD40 164 203 1.33e-4 SMART
WD40 206 249 2.56e1 SMART
DUF1900 256 317 5.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173171
AA Change: H35N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134709
Gene: ENSMUSG00000041729
AA Change: H35N

DomainStartEndE-ValueType
DUF1899 16 80 2.89e-31 SMART
Pfam:WD40 87 121 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Homozygous knockout reduces susceptibility to Doxorubicin-induced focal segmental glomerulosclerosis with lower levels of proteinuria and less renal glomerulus damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930564D02Rik G T 3: 104,985,728 (GRCm39) R47S unknown Het
Abtb2 T G 2: 103,397,757 (GRCm39) I229S probably damaging Het
Adgre1 T C 17: 57,727,441 (GRCm39) L457P probably damaging Het
Amer3 C A 1: 34,626,983 (GRCm39) D407E probably damaging Het
Arhgap20 T C 9: 51,760,335 (GRCm39) S729P probably benign Het
Asap2 T G 12: 21,279,458 (GRCm39) I418S probably benign Het
Atp5mf T C 5: 145,125,295 (GRCm39) probably null Het
Brinp3 T A 1: 146,777,824 (GRCm39) V757E probably benign Het
Brip1 C T 11: 86,029,929 (GRCm39) G572R probably benign Het
C3 C A 17: 57,530,215 (GRCm39) R462L probably benign Het
Cat T A 2: 103,293,643 (GRCm39) H395L probably benign Het
Ccdc168 G T 1: 44,098,656 (GRCm39) P814Q probably damaging Het
Cela3a T C 4: 137,129,917 (GRCm39) N235D possibly damaging Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cntnap1 G T 11: 101,076,094 (GRCm39) G993W probably damaging Het
Col9a1 A G 1: 24,218,484 (GRCm39) probably null Het
Dll3 C T 7: 27,998,536 (GRCm39) R143H probably damaging Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 (GRCm39) *114R probably null Het
Ecm2 T C 13: 49,668,554 (GRCm39) S86P probably damaging Het
Eif5 T C 12: 111,506,724 (GRCm39) probably benign Het
Ets1 T A 9: 32,644,328 (GRCm39) probably null Het
Exph5 A G 9: 53,287,196 (GRCm39) N1426D possibly damaging Het
Eya2 T C 2: 165,529,586 (GRCm39) F110L probably benign Het
Flt1 T A 5: 147,517,191 (GRCm39) E1032V probably damaging Het
Galnt5 A T 2: 57,907,205 (GRCm39) H556L probably benign Het
Glb1l3 A T 9: 26,740,299 (GRCm39) Y344N probably benign Het
Glrx3 C A 7: 137,061,015 (GRCm39) D216E possibly damaging Het
Gm45871 T A 18: 90,609,499 (GRCm39) C246S probably damaging Het
Gstm4 A G 3: 107,949,689 (GRCm39) L137P probably benign Het
Hsd17b13 T C 5: 104,116,616 (GRCm39) T169A probably damaging Het
Hydin A C 8: 111,326,994 (GRCm39) T4778P probably benign Het
Ifna15 A G 4: 88,476,220 (GRCm39) L88P probably damaging Het
Inhca T A 9: 103,159,845 (GRCm39) E22V possibly damaging Het
Kcnab1 G A 3: 65,283,952 (GRCm39) R390H probably benign Het
Kng1 C A 16: 22,886,537 (GRCm39) H161N possibly damaging Het
Lamp5 T C 2: 135,902,878 (GRCm39) V199A probably benign Het
Lrig3 G A 10: 125,845,835 (GRCm39) V755M probably damaging Het
Mad1l1 C T 5: 140,129,799 (GRCm39) R412H probably damaging Het
Marchf6 C A 15: 31,486,505 (GRCm39) C350F probably benign Het
Mastl A G 2: 23,023,401 (GRCm39) S441P probably damaging Het
Mfsd13b A T 7: 120,590,951 (GRCm39) M231L probably benign Het
Mical2 T C 7: 111,981,358 (GRCm39) V444A probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myo15a A G 11: 60,368,787 (GRCm39) M516V probably benign Het
Myo1b A T 1: 51,790,413 (GRCm39) F1110L probably damaging Het
Nbr1 T A 11: 101,460,147 (GRCm39) L381* probably null Het
Nln T C 13: 104,187,355 (GRCm39) K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 (GRCm39) S15A possibly damaging Het
Nrp2 C T 1: 62,784,663 (GRCm39) P271S probably benign Het
Obox6 A C 7: 15,568,571 (GRCm39) L102V possibly damaging Het
Or4a69 T C 2: 89,312,799 (GRCm39) S227G probably benign Het
Or4p8 T C 2: 88,727,615 (GRCm39) I109V possibly damaging Het
Or7g33 A G 9: 19,448,395 (GRCm39) M277T probably damaging Het
Or8k16 T C 2: 85,520,181 (GRCm39) M136T probably damaging Het
Pde10a A G 17: 9,186,294 (GRCm39) H567R probably damaging Het
Pdgfra C T 5: 75,343,759 (GRCm39) S760L possibly damaging Het
Pid1 T A 1: 84,136,850 (GRCm39) I94L unknown Het
Plekhn1 T C 4: 156,307,128 (GRCm39) H474R probably benign Het
Prcc A T 3: 87,776,988 (GRCm39) S329T possibly damaging Het
Pros1 G T 16: 62,739,886 (GRCm39) R445L probably damaging Het
Pxdn C A 12: 30,062,260 (GRCm39) H1370Q probably benign Het
Sgce T A 6: 4,694,106 (GRCm39) R283S probably damaging Het
Slc25a20 T G 9: 108,559,657 (GRCm39) probably null Het
Slc6a1 T C 6: 114,288,779 (GRCm39) V446A probably damaging Het
Slc6a4 C G 11: 76,907,911 (GRCm39) Y358* probably null Het
Sned1 A C 1: 93,209,458 (GRCm39) E857A probably damaging Het
Spata31e2 A T 1: 26,723,548 (GRCm39) L544Q probably benign Het
Spata31e3 T C 13: 50,399,780 (GRCm39) I849V probably benign Het
Spdye4b C T 5: 143,188,145 (GRCm39) R213C possibly damaging Het
Spry2 T G 14: 106,130,946 (GRCm39) E80A probably damaging Het
Stard9 G A 2: 120,497,015 (GRCm39) C142Y probably benign Het
Sync A T 4: 129,188,099 (GRCm39) Q377L probably benign Het
Tdrd12 A G 7: 35,185,117 (GRCm39) C718R Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmbim1 T C 1: 74,330,438 (GRCm39) E185G probably benign Het
Tyk2 T C 9: 21,019,330 (GRCm39) M1031V probably damaging Het
Vmn1r71 C T 7: 10,482,428 (GRCm39) V87I not run Het
Vmn2r49 A G 7: 9,720,741 (GRCm39) V250A probably benign Het
Yipf3 A C 17: 46,561,753 (GRCm39) T187P probably damaging Het
Zfp148 G T 16: 33,255,160 (GRCm39) R50L possibly damaging Het
Zfp628 G A 7: 4,924,817 (GRCm39) G1013E probably damaging Het
Other mutations in Coro2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Coro2b APN 9 62,333,090 (GRCm39) missense probably damaging 0.99
IGL01834:Coro2b APN 9 62,338,639 (GRCm39) missense possibly damaging 0.93
IGL03242:Coro2b APN 9 62,336,243 (GRCm39) nonsense probably null
PIT4151001:Coro2b UTSW 9 62,336,286 (GRCm39) missense probably damaging 1.00
R0422:Coro2b UTSW 9 62,335,259 (GRCm39) missense probably benign 0.00
R0835:Coro2b UTSW 9 62,333,119 (GRCm39) missense possibly damaging 0.68
R0944:Coro2b UTSW 9 62,335,263 (GRCm39) missense probably benign 0.08
R1115:Coro2b UTSW 9 62,338,609 (GRCm39) missense probably damaging 0.96
R1254:Coro2b UTSW 9 62,336,247 (GRCm39) missense probably damaging 0.98
R1422:Coro2b UTSW 9 62,336,229 (GRCm39) critical splice donor site probably null
R1532:Coro2b UTSW 9 62,396,705 (GRCm39) missense probably damaging 1.00
R1543:Coro2b UTSW 9 62,333,123 (GRCm39) missense probably benign 0.32
R3424:Coro2b UTSW 9 62,336,590 (GRCm39) splice site probably null
R3971:Coro2b UTSW 9 62,336,522 (GRCm39) missense possibly damaging 0.55
R3972:Coro2b UTSW 9 62,336,522 (GRCm39) missense possibly damaging 0.55
R4035:Coro2b UTSW 9 62,333,071 (GRCm39) unclassified probably benign
R4233:Coro2b UTSW 9 62,333,467 (GRCm39) missense possibly damaging 0.69
R4734:Coro2b UTSW 9 62,333,860 (GRCm39) missense probably benign 0.02
R4825:Coro2b UTSW 9 62,361,905 (GRCm39) missense probably benign 0.30
R5332:Coro2b UTSW 9 62,336,512 (GRCm39) missense probably damaging 0.97
R5702:Coro2b UTSW 9 62,333,859 (GRCm39) missense probably damaging 0.97
R6474:Coro2b UTSW 9 62,333,910 (GRCm39) missense probably benign 0.16
R6500:Coro2b UTSW 9 62,396,606 (GRCm39) missense probably benign 0.24
R6674:Coro2b UTSW 9 62,339,709 (GRCm39) missense probably damaging 1.00
R7102:Coro2b UTSW 9 62,328,667 (GRCm39) missense possibly damaging 0.81
R8199:Coro2b UTSW 9 62,336,302 (GRCm39) missense probably benign 0.00
R8447:Coro2b UTSW 9 62,333,842 (GRCm39) missense probably damaging 1.00
R8970:Coro2b UTSW 9 62,333,809 (GRCm39) unclassified probably benign
R9023:Coro2b UTSW 9 62,332,978 (GRCm39) missense
R9211:Coro2b UTSW 9 62,427,662 (GRCm39) missense probably benign 0.06
R9325:Coro2b UTSW 9 62,396,609 (GRCm39) missense probably benign
R9443:Coro2b UTSW 9 62,333,080 (GRCm39) missense probably benign 0.21
R9516:Coro2b UTSW 9 62,335,291 (GRCm39) nonsense probably null
R9653:Coro2b UTSW 9 62,335,259 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAATCAGAATCTCAGGGC -3'
(R):5'- TAGGTCCCATGCTCTTGGTG -3'

Sequencing Primer
(F):5'- GCAACCAGGGCCACTTAC -3'
(R):5'- TCTCATCCATCCGTGAAAATGGG -3'
Posted On 2019-09-13