Mutagenetix > Incidental Mutation

Incidental Mutation 'R7347:Lrig3'

570296

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9030421L11Rik, 9430095K15Rik, 9130004I02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.312) question?

Stock #

R7347 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125966168-126015359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 126009966 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 755 (V755M)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

AlphaFold

Q6P1C6

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074807
AA Change: V755M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: V755M

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	A	9: 103,282,646	E22V	possibly damaging	Het
4930564D02Rik	G	T	3: 105,078,412	R47S	unknown	Het
4931408C20Rik	A	T	1: 26,684,467	L544Q	probably benign	Het
Abtb2	T	G	2: 103,567,412	I229S	probably damaging	Het
Adgre1	T	C	17: 57,420,441	L457P	probably damaging	Het
Amer3	C	A	1: 34,587,902	D407E	probably damaging	Het
Arhgap20	T	C	9: 51,849,035	S729P	probably benign	Het
Asap2	T	G	12: 21,229,457	I418S	probably benign	Het
Atp5j2	T	C	5: 145,188,485		probably null	Het
Brinp3	T	A	1: 146,902,086	V757E	probably benign	Het
Brip1	C	T	11: 86,139,103	G572R	probably benign	Het
C3	C	A	17: 57,223,215	R462L	probably benign	Het
Cat	T	A	2: 103,463,298	H395L	probably benign	Het
Cela3a	T	C	4: 137,402,606	N235D	possibly damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cntnap1	G	T	11: 101,185,268	G993W	probably damaging	Het
Col9a1	A	G	1: 24,179,403		probably null	Het
Coro2b	G	T	9: 62,489,372	H29N	probably benign	Het
Dll3	C	T	7: 28,299,111	R143H	probably damaging	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
Dync1i1	T	A	6: 5,784,530	*114R	probably null	Het
Ecm2	T	C	13: 49,515,078	S86P	probably damaging	Het
Eif5	T	C	12: 111,540,290		probably benign	Het
Ets1	T	A	9: 32,733,032		probably null	Het
Exph5	A	G	9: 53,375,896	N1426D	possibly damaging	Het
Eya2	T	C	2: 165,687,666	F110L	probably benign	Het
Flt1	T	A	5: 147,580,381	E1032V	probably damaging	Het
Galnt5	A	T	2: 58,017,193	H556L	probably benign	Het
Glb1l3	A	T	9: 26,829,003	Y344N	probably benign	Het
Glrx3	C	A	7: 137,459,286	D216E	possibly damaging	Het
Gm45871	T	A	18: 90,591,375	C246S	probably damaging	Het
Gm8251	G	T	1: 44,059,496	P814Q	probably damaging	Het
Gm906	T	C	13: 50,245,744	I849V	probably benign	Het
Gstm4	A	G	3: 108,042,373	L137P	probably benign	Het
Hsd17b13	T	C	5: 103,968,750	T169A	probably damaging	Het
Hydin	A	C	8: 110,600,362	T4778P	probably benign	Het
Ifna15	A	G	4: 88,557,983	L88P	probably damaging	Het
Kcnab1	G	A	3: 65,376,531	R390H	probably benign	Het
Kng1	C	A	16: 23,067,787	H161N	possibly damaging	Het
Lamp5	T	C	2: 136,060,958	V199A	probably benign	Het
Mad1l1	C	T	5: 140,144,044	R412H	probably damaging	Het
March6	C	A	15: 31,486,359	C350F	probably benign	Het
Mastl	A	G	2: 23,133,389	S441P	probably damaging	Het
Mfsd13b	A	T	7: 120,991,728	M231L	probably benign	Het
Micalcl	T	C	7: 112,382,151	V444A	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo15	A	G	11: 60,477,961	M516V	probably benign	Het
Myo1b	A	T	1: 51,751,254	F1110L	probably damaging	Het
Nbr1	T	A	11: 101,569,321	L381*	probably null	Het
Nln	T	C	13: 104,050,847	K325E	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Nrp2	C	T	1: 62,745,504	P271S	probably benign	Het
Obox6	A	C	7: 15,834,646	L102V	possibly damaging	Het
Olfr1008	T	C	2: 85,689,837	M136T	probably damaging	Het
Olfr1208	T	C	2: 88,897,271	I109V	possibly damaging	Het
Olfr1241	T	C	2: 89,482,455	S227G	probably benign	Het
Olfr853	A	G	9: 19,537,099	M277T	probably damaging	Het
Pde10a	A	G	17: 8,967,462	H567R	probably damaging	Het
Pdgfra	C	T	5: 75,183,098	S760L	possibly damaging	Het
Pid1	T	A	1: 84,159,129	I94L	unknown	Het
Plekhn1	T	C	4: 156,222,671	H474R	probably benign	Het
Prcc	A	T	3: 87,869,681	S329T	possibly damaging	Het
Pros1	G	T	16: 62,919,523	R445L	probably damaging	Het
Pxdn	C	A	12: 30,012,261	H1370Q	probably benign	Het
Sgce	T	A	6: 4,694,106	R283S	probably damaging	Het
Slc25a20	T	G	9: 108,682,458		probably null	Het
Slc6a1	T	C	6: 114,311,818	V446A	probably damaging	Het
Slc6a4	C	G	11: 77,017,085	Y358*	probably null	Het
Sned1	A	C	1: 93,281,736	E857A	probably damaging	Het
Spdye4b	C	T	5: 143,202,390	R213C	possibly damaging	Het
Spry2	T	G	14: 105,893,512	E80A	probably damaging	Het
Stard9	G	A	2: 120,666,534	C142Y	probably benign	Het
Sync	A	T	4: 129,294,306	Q377L	probably benign	Het
Tdrd12	A	G	7: 35,485,692	C718R		Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmbim1	T	C	1: 74,291,279	E185G	probably benign	Het
Tyk2	T	C	9: 21,108,034	M1031V	probably damaging	Het
Vmn1r71	C	T	7: 10,748,501	V87I	not run	Het
Vmn2r49	A	G	7: 9,986,814	V250A	probably benign	Het
Yipf3	A	C	17: 46,250,827	T187P	probably damaging	Het
Zfp148	G	T	16: 33,434,790	R50L	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	126013148	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125972137	nonsense	probably null
IGL00969:Lrig3	APN	10	125997115	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125994466	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	126008698	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	126010017	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125997172	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	126014874	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125966594	missense	probably benign
IGL02832:Lrig3	APN	10	126007002	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	126013282	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	126010219	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	126006943	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	126010192	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125972117	splice site	probably benign
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0336:Lrig3	UTSW	10	125966705	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	126013448	nonsense	probably null
R0502:Lrig3	UTSW	10	126008736	missense	probably damaging	1.00
R0639:Lrig3	UTSW	10	126010221	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	126007014	splice site	probably null
R1220:Lrig3	UTSW	10	125997076	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	126002971	missense	probably damaging	1.00
R1398:Lrig3	UTSW	10	126003088	missense	probably benign	0.00
R1451:Lrig3	UTSW	10	126010057	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	126008698	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	126008547	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	126010167	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	126010075	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125997051	splice site	probably null
R1840:Lrig3	UTSW	10	126013389	nonsense	probably null
R1882:Lrig3	UTSW	10	126009825	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	126002393	splice site	probably benign
R2160:Lrig3	UTSW	10	125997696	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125996609	splice site	probably null
R2294:Lrig3	UTSW	10	125966494	nonsense	probably null
R2518:Lrig3	UTSW	10	125994441	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	126010032	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125997187	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	126013408	missense	probably benign
R4074:Lrig3	UTSW	10	126013408	missense	probably benign
R4075:Lrig3	UTSW	10	126013408	missense	probably benign
R4077:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4079:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	126011008	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	126013404	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	126013347	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125996613	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	126013151	missense	possibly damaging	0.48
R5307:Lrig3	UTSW	10	126006690	missense	probably damaging	1.00
R5402:Lrig3	UTSW	10	126008740	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125972134	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	126009919	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	126008478	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	126010979	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125996609	splice site	probably null
R6985:Lrig3	UTSW	10	126014869	missense	possibly damaging	0.64
R7089:Lrig3	UTSW	10	125997124	missense	probably damaging	1.00
R7177:Lrig3	UTSW	10	126006843	missense	probably benign	0.02
R9093:Lrig3	UTSW	10	126010081	missense	possibly damaging	0.51
R9188:Lrig3	UTSW	10	126003066	missense	possibly damaging	0.80
R9295:Lrig3	UTSW	10	126014853	missense	probably benign	0.00
R9378:Lrig3	UTSW	10	125997084	missense	probably damaging	0.98
R9526:Lrig3	UTSW	10	126014867	missense	probably benign
R9567:Lrig3	UTSW	10	126010095	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTTGCGGCCCCTGTTAGAC -3'
(R):5'- TGTGTGGTATATGATGACCACC -3'

Sequencing Primer
(F):5'- TGTTAGACAGAACCGTCACCAAGG -3'
(R):5'- TGTGGTATATGATGACCACCCACAC -3'

Posted On

2019-09-13