Mutagenetix > Incidental Mutation

Incidental Mutation 'R7347:Slc6a4'

570298

Institutional Source

Beutler Lab

Gene Symbol

Slc6a4

Ensembl Gene

ENSMUSG00000020838

Gene Name

solute carrier family 6 (neurotransmitter transporter, serotonin), member 4

Synonyms

5-HTT, Sert, Htt

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.417) question?

Stock #

R7347 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76998603-77032340 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to G at 77017085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 358 (Y358*)

Ref Sequence

ENSEMBL: ENSMUSP00000021195 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021195] [ENSMUST00000108402] [ENSMUST00000129572]

AlphaFold

Q60857

Predicted Effect

probably null
Transcript: ENSMUST00000021195
AA Change: Y358*

SMART Domains

Protein: ENSMUSP00000021195
Gene: ENSMUSG00000020838
AA Change: Y358*

Domain	Start	End	E-Value	Type
Pfam:5HT_transport_N	24	64	3e-27	PFAM
Pfam:SNF	79	600	7.3e-232	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108402
AA Change: Y358*

SMART Domains

Protein: ENSMUSP00000104039
Gene: ENSMUSG00000020838
AA Change: Y358*

Domain	Start	End	E-Value	Type
Pfam:5HT_transporter	23	64	7.8e-30	PFAM
Pfam:SNF	79	600	7.3e-232	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129572

SMART Domains

Protein: ENSMUSP00000115264
Gene: ENSMUSG00000020838

Domain	Start	End	E-Value	Type
Pfam:5HT_transporter	23	64	1e-30	PFAM
Pfam:SNF	79	158	1.8e-46	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake and may play a role in sudden infant death syndrome, aggressive behavior in Alzheimer disease patients, and depression-susceptibility in people experiencing emotional trauma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit greatly diminished brain serotonin levels and lack cortical barrel patterns. Also, mutants lack the locomotor enhancing response to the drug (+)-3,4-methylenedioxymethamphetamine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	A	9: 103,282,646	E22V	possibly damaging	Het
4930564D02Rik	G	T	3: 105,078,412	R47S	unknown	Het
4931408C20Rik	A	T	1: 26,684,467	L544Q	probably benign	Het
Abtb2	T	G	2: 103,567,412	I229S	probably damaging	Het
Adgre1	T	C	17: 57,420,441	L457P	probably damaging	Het
Amer3	C	A	1: 34,587,902	D407E	probably damaging	Het
Arhgap20	T	C	9: 51,849,035	S729P	probably benign	Het
Asap2	T	G	12: 21,229,457	I418S	probably benign	Het
Atp5j2	T	C	5: 145,188,485		probably null	Het
Brinp3	T	A	1: 146,902,086	V757E	probably benign	Het
Brip1	C	T	11: 86,139,103	G572R	probably benign	Het
C3	C	A	17: 57,223,215	R462L	probably benign	Het
Cat	T	A	2: 103,463,298	H395L	probably benign	Het
Cela3a	T	C	4: 137,402,606	N235D	possibly damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cntnap1	G	T	11: 101,185,268	G993W	probably damaging	Het
Col9a1	A	G	1: 24,179,403		probably null	Het
Coro2b	G	T	9: 62,489,372	H29N	probably benign	Het
Dll3	C	T	7: 28,299,111	R143H	probably damaging	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
Dync1i1	T	A	6: 5,784,530	*114R	probably null	Het
Ecm2	T	C	13: 49,515,078	S86P	probably damaging	Het
Eif5	T	C	12: 111,540,290		probably benign	Het
Ets1	T	A	9: 32,733,032		probably null	Het
Exph5	A	G	9: 53,375,896	N1426D	possibly damaging	Het
Eya2	T	C	2: 165,687,666	F110L	probably benign	Het
Flt1	T	A	5: 147,580,381	E1032V	probably damaging	Het
Galnt5	A	T	2: 58,017,193	H556L	probably benign	Het
Glb1l3	A	T	9: 26,829,003	Y344N	probably benign	Het
Glrx3	C	A	7: 137,459,286	D216E	possibly damaging	Het
Gm45871	T	A	18: 90,591,375	C246S	probably damaging	Het
Gm8251	G	T	1: 44,059,496	P814Q	probably damaging	Het
Gm906	T	C	13: 50,245,744	I849V	probably benign	Het
Gstm4	A	G	3: 108,042,373	L137P	probably benign	Het
Hsd17b13	T	C	5: 103,968,750	T169A	probably damaging	Het
Hydin	A	C	8: 110,600,362	T4778P	probably benign	Het
Ifna15	A	G	4: 88,557,983	L88P	probably damaging	Het
Kcnab1	G	A	3: 65,376,531	R390H	probably benign	Het
Kng1	C	A	16: 23,067,787	H161N	possibly damaging	Het
Lamp5	T	C	2: 136,060,958	V199A	probably benign	Het
Lrig3	G	A	10: 126,009,966	V755M	probably damaging	Het
Mad1l1	C	T	5: 140,144,044	R412H	probably damaging	Het
March6	C	A	15: 31,486,359	C350F	probably benign	Het
Mastl	A	G	2: 23,133,389	S441P	probably damaging	Het
Mfsd13b	A	T	7: 120,991,728	M231L	probably benign	Het
Micalcl	T	C	7: 112,382,151	V444A	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo15	A	G	11: 60,477,961	M516V	probably benign	Het
Myo1b	A	T	1: 51,751,254	F1110L	probably damaging	Het
Nbr1	T	A	11: 101,569,321	L381*	probably null	Het
Nln	T	C	13: 104,050,847	K325E	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Nrp2	C	T	1: 62,745,504	P271S	probably benign	Het
Obox6	A	C	7: 15,834,646	L102V	possibly damaging	Het
Olfr1008	T	C	2: 85,689,837	M136T	probably damaging	Het
Olfr1208	T	C	2: 88,897,271	I109V	possibly damaging	Het
Olfr1241	T	C	2: 89,482,455	S227G	probably benign	Het
Olfr853	A	G	9: 19,537,099	M277T	probably damaging	Het
Pde10a	A	G	17: 8,967,462	H567R	probably damaging	Het
Pdgfra	C	T	5: 75,183,098	S760L	possibly damaging	Het
Pid1	T	A	1: 84,159,129	I94L	unknown	Het
Plekhn1	T	C	4: 156,222,671	H474R	probably benign	Het
Prcc	A	T	3: 87,869,681	S329T	possibly damaging	Het
Pros1	G	T	16: 62,919,523	R445L	probably damaging	Het
Pxdn	C	A	12: 30,012,261	H1370Q	probably benign	Het
Sgce	T	A	6: 4,694,106	R283S	probably damaging	Het
Slc25a20	T	G	9: 108,682,458		probably null	Het
Slc6a1	T	C	6: 114,311,818	V446A	probably damaging	Het
Sned1	A	C	1: 93,281,736	E857A	probably damaging	Het
Spdye4b	C	T	5: 143,202,390	R213C	possibly damaging	Het
Spry2	T	G	14: 105,893,512	E80A	probably damaging	Het
Stard9	G	A	2: 120,666,534	C142Y	probably benign	Het
Sync	A	T	4: 129,294,306	Q377L	probably benign	Het
Tdrd12	A	G	7: 35,485,692	C718R		Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmbim1	T	C	1: 74,291,279	E185G	probably benign	Het
Tyk2	T	C	9: 21,108,034	M1031V	probably damaging	Het
Vmn1r71	C	T	7: 10,748,501	V87I	not run	Het
Vmn2r49	A	G	7: 9,986,814	V250A	probably benign	Het
Yipf3	A	C	17: 46,250,827	T187P	probably damaging	Het
Zfp148	G	T	16: 33,434,790	R50L	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Slc6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Slc6a4	APN	11	77023180	missense	probably benign	0.00
IGL01403:Slc6a4	APN	11	77031672	missense	probably benign	0.00
IGL01608:Slc6a4	APN	11	77027135	missense	probably damaging	1.00
IGL01759:Slc6a4	APN	11	77013288	missense	probably damaging	1.00
IGL02239:Slc6a4	APN	11	77027156	missense	probably benign	0.01
IGL02491:Slc6a4	APN	11	77027208	missense	probably damaging	1.00
IGL03221:Slc6a4	APN	11	77027105	missense	probably benign
R1122:Slc6a4	UTSW	11	77027186	missense	possibly damaging	0.90
R1574:Slc6a4	UTSW	11	77019196	missense	possibly damaging	0.93
R1574:Slc6a4	UTSW	11	77019196	missense	possibly damaging	0.93
R1768:Slc6a4	UTSW	11	77013252	missense	probably damaging	1.00
R1876:Slc6a4	UTSW	11	77015164	missense	probably benign	0.34
R1884:Slc6a4	UTSW	11	77013375	missense	probably benign	0.01
R4362:Slc6a4	UTSW	11	77017078	missense	probably damaging	1.00
R4595:Slc6a4	UTSW	11	77019863	missense	probably benign	0.16
R4855:Slc6a4	UTSW	11	77013309	missense	probably damaging	1.00
R5569:Slc6a4	UTSW	11	77023255	missense	possibly damaging	0.88
R5747:Slc6a4	UTSW	11	77010511	missense	probably damaging	0.97
R5802:Slc6a4	UTSW	11	77019236	missense	probably damaging	1.00
R6242:Slc6a4	UTSW	11	77018358	nonsense	probably null
R6344:Slc6a4	UTSW	11	77018254	missense	probably damaging	1.00
R6443:Slc6a4	UTSW	11	77023201	missense	probably benign	0.05
R6935:Slc6a4	UTSW	11	77027168	missense	probably benign	0.06
R7283:Slc6a4	UTSW	11	77010696	missense	probably benign
R7313:Slc6a4	UTSW	11	77010701	missense	possibly damaging	0.75
R7535:Slc6a4	UTSW	11	77015150	missense	possibly damaging	0.70
R7826:Slc6a4	UTSW	11	77013025	missense	probably benign	0.27
R8055:Slc6a4	UTSW	11	77010598	missense	probably benign	0.00
R9296:Slc6a4	UTSW	11	77018284	missense	probably benign	0.19
R9325:Slc6a4	UTSW	11	77019173	missense	probably benign	0.13
RF007:Slc6a4	UTSW	11	77019182	missense	probably damaging	1.00
Z1177:Slc6a4	UTSW	11	77016683	frame shift	probably null
Z1186:Slc6a4	UTSW	11	77010556	missense	probably benign
Z1186:Slc6a4	UTSW	11	77013032	missense	probably benign
Z1187:Slc6a4	UTSW	11	77010556	missense	probably benign
Z1187:Slc6a4	UTSW	11	77013032	missense	probably benign
Z1188:Slc6a4	UTSW	11	77010556	missense	probably benign
Z1188:Slc6a4	UTSW	11	77013032	missense	probably benign
Z1189:Slc6a4	UTSW	11	77010556	missense	probably benign
Z1189:Slc6a4	UTSW	11	77013032	missense	probably benign
Z1190:Slc6a4	UTSW	11	77010556	missense	probably benign
Z1190:Slc6a4	UTSW	11	77013032	missense	probably benign
Z1192:Slc6a4	UTSW	11	77010556	missense	probably benign
Z1192:Slc6a4	UTSW	11	77013032	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAAGTGTGTGATGATCCTTTCG -3'
(R):5'- TTACTTCCTGAACGGGCAC -3'

Sequencing Primer
(F):5'- ACAGCATCTTGAGGCTACTG -3'
(R):5'- ACAGCCCTTAGGGACAAT -3'

Posted On

2019-09-13