Mutagenetix > Incidental Mutation

Incidental Mutation 'R7347:Brip1'

570299

Institutional Source

Beutler Lab

Gene Symbol

Brip1

Ensembl Gene

ENSMUSG00000034329

Gene Name

BRCA1 interacting protein C-terminal helicase 1

Synonyms

8030460J03Rik, 3110009N10Rik, BACH1

MMRRC Submission

045374-MU

Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7347 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86058138-86201193 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86139103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 572 (G572R)

Ref Sequence

ENSEMBL: ENSMUSP00000043108 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044423]

AlphaFold

Q5SXJ3

Predicted Effect

probably benign
Transcript: ENSMUST00000044423
AA Change: G572R

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: G572R

Domain	Start	End	E-Value	Type
DEXDc	17	520	1.4e-3	SMART
HELICc	701	854	8.2e-41	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	A	9: 103,282,646	E22V	possibly damaging	Het
4930564D02Rik	G	T	3: 105,078,412	R47S	unknown	Het
4931408C20Rik	A	T	1: 26,684,467	L544Q	probably benign	Het
Abtb2	T	G	2: 103,567,412	I229S	probably damaging	Het
Adgre1	T	C	17: 57,420,441	L457P	probably damaging	Het
Amer3	C	A	1: 34,587,902	D407E	probably damaging	Het
Arhgap20	T	C	9: 51,849,035	S729P	probably benign	Het
Asap2	T	G	12: 21,229,457	I418S	probably benign	Het
Atp5j2	T	C	5: 145,188,485		probably null	Het
Brinp3	T	A	1: 146,902,086	V757E	probably benign	Het
C3	C	A	17: 57,223,215	R462L	probably benign	Het
Cat	T	A	2: 103,463,298	H395L	probably benign	Het
Cela3a	T	C	4: 137,402,606	N235D	possibly damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cntnap1	G	T	11: 101,185,268	G993W	probably damaging	Het
Col9a1	A	G	1: 24,179,403		probably null	Het
Coro2b	G	T	9: 62,489,372	H29N	probably benign	Het
Dll3	C	T	7: 28,299,111	R143H	probably damaging	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
Dync1i1	T	A	6: 5,784,530	*114R	probably null	Het
Ecm2	T	C	13: 49,515,078	S86P	probably damaging	Het
Eif5	T	C	12: 111,540,290		probably benign	Het
Ets1	T	A	9: 32,733,032		probably null	Het
Exph5	A	G	9: 53,375,896	N1426D	possibly damaging	Het
Eya2	T	C	2: 165,687,666	F110L	probably benign	Het
Flt1	T	A	5: 147,580,381	E1032V	probably damaging	Het
Galnt5	A	T	2: 58,017,193	H556L	probably benign	Het
Glb1l3	A	T	9: 26,829,003	Y344N	probably benign	Het
Glrx3	C	A	7: 137,459,286	D216E	possibly damaging	Het
Gm45871	T	A	18: 90,591,375	C246S	probably damaging	Het
Gm8251	G	T	1: 44,059,496	P814Q	probably damaging	Het
Gm906	T	C	13: 50,245,744	I849V	probably benign	Het
Gstm4	A	G	3: 108,042,373	L137P	probably benign	Het
Hsd17b13	T	C	5: 103,968,750	T169A	probably damaging	Het
Hydin	A	C	8: 110,600,362	T4778P	probably benign	Het
Ifna15	A	G	4: 88,557,983	L88P	probably damaging	Het
Kcnab1	G	A	3: 65,376,531	R390H	probably benign	Het
Kng1	C	A	16: 23,067,787	H161N	possibly damaging	Het
Lamp5	T	C	2: 136,060,958	V199A	probably benign	Het
Lrig3	G	A	10: 126,009,966	V755M	probably damaging	Het
Mad1l1	C	T	5: 140,144,044	R412H	probably damaging	Het
March6	C	A	15: 31,486,359	C350F	probably benign	Het
Mastl	A	G	2: 23,133,389	S441P	probably damaging	Het
Mfsd13b	A	T	7: 120,991,728	M231L	probably benign	Het
Micalcl	T	C	7: 112,382,151	V444A	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo15	A	G	11: 60,477,961	M516V	probably benign	Het
Myo1b	A	T	1: 51,751,254	F1110L	probably damaging	Het
Nbr1	T	A	11: 101,569,321	L381*	probably null	Het
Nln	T	C	13: 104,050,847	K325E	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Nrp2	C	T	1: 62,745,504	P271S	probably benign	Het
Obox6	A	C	7: 15,834,646	L102V	possibly damaging	Het
Olfr1008	T	C	2: 85,689,837	M136T	probably damaging	Het
Olfr1208	T	C	2: 88,897,271	I109V	possibly damaging	Het
Olfr1241	T	C	2: 89,482,455	S227G	probably benign	Het
Olfr853	A	G	9: 19,537,099	M277T	probably damaging	Het
Pde10a	A	G	17: 8,967,462	H567R	probably damaging	Het
Pdgfra	C	T	5: 75,183,098	S760L	possibly damaging	Het
Pid1	T	A	1: 84,159,129	I94L	unknown	Het
Plekhn1	T	C	4: 156,222,671	H474R	probably benign	Het
Prcc	A	T	3: 87,869,681	S329T	possibly damaging	Het
Pros1	G	T	16: 62,919,523	R445L	probably damaging	Het
Pxdn	C	A	12: 30,012,261	H1370Q	probably benign	Het
Sgce	T	A	6: 4,694,106	R283S	probably damaging	Het
Slc25a20	T	G	9: 108,682,458		probably null	Het
Slc6a1	T	C	6: 114,311,818	V446A	probably damaging	Het
Slc6a4	C	G	11: 77,017,085	Y358*	probably null	Het
Sned1	A	C	1: 93,281,736	E857A	probably damaging	Het
Spdye4b	C	T	5: 143,202,390	R213C	possibly damaging	Het
Spry2	T	G	14: 105,893,512	E80A	probably damaging	Het
Stard9	G	A	2: 120,666,534	C142Y	probably benign	Het
Sync	A	T	4: 129,294,306	Q377L	probably benign	Het
Tdrd12	A	G	7: 35,485,692	C718R		Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmbim1	T	C	1: 74,291,279	E185G	probably benign	Het
Tyk2	T	C	9: 21,108,034	M1031V	probably damaging	Het
Vmn1r71	C	T	7: 10,748,501	V87I	not run	Het
Vmn2r49	A	G	7: 9,986,814	V250A	probably benign	Het
Yipf3	A	C	17: 46,250,827	T187P	probably damaging	Het
Zfp148	G	T	16: 33,434,790	R50L	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Brip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Brip1	APN	11	86148401	missense	possibly damaging	0.53
IGL01098:Brip1	APN	11	86108862	missense	possibly damaging	0.71
IGL01503:Brip1	APN	11	86061877	missense	probably benign	0.33
IGL01602:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01605:Brip1	APN	11	86062004	missense	possibly damaging	0.53
IGL01940:Brip1	APN	11	86064966	missense	probably benign	0.00
IGL02019:Brip1	APN	11	86197949	missense	possibly damaging	0.73
IGL02212:Brip1	APN	11	86139015	missense	possibly damaging	0.86
IGL02456:Brip1	APN	11	86065099	missense	possibly damaging	0.71
IGL02727:Brip1	APN	11	86152736	missense	probably benign	0.02
IGL02983:Brip1	APN	11	86139124	missense	probably benign	0.03
IGL03022:Brip1	APN	11	86077950	missense	probably damaging	0.98
IGL03116:Brip1	APN	11	86064909	nonsense	probably null
IGL03143:Brip1	APN	11	86061827	missense	possibly damaging	0.53
blip	UTSW	11	86074298	missense	possibly damaging	0.85
Microwave	UTSW	11	86152706	missense	possibly damaging	0.93
radar	UTSW	11	86152669	nonsense	probably null
P0018:Brip1	UTSW	11	86108868	missense	possibly damaging	0.51
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0011:Brip1	UTSW	11	86186998	missense	possibly damaging	0.72
R0446:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R0498:Brip1	UTSW	11	86197919	missense	possibly damaging	0.96
R0599:Brip1	UTSW	11	86152737	missense	probably benign
R0653:Brip1	UTSW	11	86152658	missense	possibly damaging	0.85
R0661:Brip1	UTSW	11	86110363	missense	possibly damaging	0.86
R0671:Brip1	UTSW	11	86152667	missense	possibly damaging	0.93
R0718:Brip1	UTSW	11	86143305	missense	possibly damaging	0.96
R0750:Brip1	UTSW	11	86061499	missense	possibly damaging	0.53
R0834:Brip1	UTSW	11	86192827	missense	probably benign
R1128:Brip1	UTSW	11	86064937	missense	possibly damaging	0.86
R1726:Brip1	UTSW	11	86064914	missense	probably benign	0.17
R1813:Brip1	UTSW	11	86187080	missense	possibly damaging	0.53
R1885:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R1886:Brip1	UTSW	11	86138815	missense	probably damaging	1.00
R2093:Brip1	UTSW	11	86139145	missense	possibly damaging	0.53
R2206:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R2207:Brip1	UTSW	11	86061877	missense	probably benign	0.33
R3404:Brip1	UTSW	11	86143263	missense	possibly damaging	0.96
R3421:Brip1	UTSW	11	86152669	nonsense	probably null
R3876:Brip1	UTSW	11	86152790	missense	probably damaging	0.98
R4018:Brip1	UTSW	11	86138851	missense	possibly damaging	0.86
R4092:Brip1	UTSW	11	86148521	missense	possibly damaging	0.92
R4384:Brip1	UTSW	11	86148429	missense	possibly damaging	0.70
R4394:Brip1	UTSW	11	86074298	missense	possibly damaging	0.85
R4518:Brip1	UTSW	11	86077878	missense	possibly damaging	0.92
R4522:Brip1	UTSW	11	86189801	missense	possibly damaging	0.49
R4840:Brip1	UTSW	11	86146183	missense	possibly damaging	0.86
R5025:Brip1	UTSW	11	86064980	missense	probably benign	0.04
R5176:Brip1	UTSW	11	86077884	missense	probably damaging	0.98
R5213:Brip1	UTSW	11	86143321	missense	possibly damaging	0.73
R5470:Brip1	UTSW	11	86148542	missense	possibly damaging	0.71
R5525:Brip1	UTSW	11	86110447	missense	possibly damaging	0.85
R6057:Brip1	UTSW	11	86065039	missense	possibly damaging	0.73
R6819:Brip1	UTSW	11	86110441	missense	possibly damaging	0.51
R6908:Brip1	UTSW	11	86077884	missense	probably damaging	0.98
R6920:Brip1	UTSW	11	86148536	nonsense	probably null
R7053:Brip1	UTSW	11	86192965	missense	possibly damaging	0.53
R7235:Brip1	UTSW	11	86138875	missense	possibly damaging	0.53
R7253:Brip1	UTSW	11	86143278	missense	possibly damaging	0.96
R7476:Brip1	UTSW	11	86157808	missense	probably benign	0.33
R7580:Brip1	UTSW	11	86157601	missense	probably damaging	0.98
R7639:Brip1	UTSW	11	86152822	splice site	probably null
R7771:Brip1	UTSW	11	86062024	missense	probably benign	0.02
R8125:Brip1	UTSW	11	86186991	missense	possibly damaging	0.73
R8236:Brip1	UTSW	11	86139112	missense	probably damaging	0.98
R8509:Brip1	UTSW	11	86197948	nonsense	probably null
R8815:Brip1	UTSW	11	86189772	missense	probably benign	0.17
R8877:Brip1	UTSW	11	86152706	missense	possibly damaging	0.93
R8938:Brip1	UTSW	11	86148401	missense	possibly damaging	0.53
R9038:Brip1	UTSW	11	86189773	missense	probably benign	0.01
R9104:Brip1	UTSW	11	86187071	missense	possibly damaging	0.86
R9466:Brip1	UTSW	11	86157758	missense	possibly damaging	0.71
R9645:Brip1	UTSW	11	86061686	missense	probably benign	0.18
R9703:Brip1	UTSW	11	86062004	missense	possibly damaging	0.53
R9774:Brip1	UTSW	11	86187012	missense	possibly damaging	0.73
X0060:Brip1	UTSW	11	86152619	missense	possibly damaging	0.71
X0062:Brip1	UTSW	11	86143356	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- TTAATATCTGAAAAGGCCTGCAAGG -3'
(R):5'- GGAAGGCATGACACTGTTCAG -3'

Sequencing Primer
(F):5'- GGCCTGCAAGGAAACACCAG -3'
(R):5'- CACTGTTCAGTTTTGAAGTTACCAGG -3'

Posted On

2019-09-13