Mutagenetix > Incidental Mutation

Incidental Mutation 'R7347:Asap2'

570302

Institutional Source

Beutler Lab

Gene Symbol

Asap2

Ensembl Gene

ENSMUSG00000052632

Gene Name

ArfGAP with SH3 domain, ankyrin repeat and PH domain 2

Synonyms

6530401G17Rik, LOC385250, Ddef2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R7347 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20990459-21270171 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 21229457 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 418 (I418S)

Ref Sequence

ENSEMBL: ENSMUSP00000099098 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]

AlphaFold

Q7SIG6

Predicted Effect

probably damaging
Transcript: ENSMUST00000050990
AA Change: I415S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: I415S

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
PH	306	399	2.31e-18	SMART
ArfGap	421	541	6.82e-27	SMART
ANK	584	616	6.17e-1	SMART
ANK	620	649	4.03e-5	SMART
ANK	653	683	1.48e3	SMART
low complexity region	693	707	N/A	INTRINSIC
low complexity region	765	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
SH3	896	954	4.28e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000064595
AA Change: I415S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: I415S

Domain	Start	End	E-Value	Type
Pfam:BAR	11	247	2.4e-9	PFAM
Pfam:BAR_3	31	265	3.3e-28	PFAM
PH	306	399	2.31e-18	SMART
ArfGap	421	541	6.82e-27	SMART
ANK	584	616	6.17e-1	SMART
ANK	620	649	4.03e-5	SMART
ANK	653	683	1.48e3	SMART
low complexity region	693	707	N/A	INTRINSIC
low complexity region	765	789	N/A	INTRINSIC
low complexity region	837	849	N/A	INTRINSIC
low complexity region	872	892	N/A	INTRINSIC
SH3	941	999	4.28e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090834

SMART Domains

Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
Blast:PH	196	318	1e-50	BLAST
Blast:ArfGap	334	395	5e-30	BLAST
ANK	438	470	6.17e-1	SMART
ANK	474	503	4.03e-5	SMART
ANK	507	537	1.48e3	SMART
low complexity region	547	561	N/A	INTRINSIC
low complexity region	619	643	N/A	INTRINSIC
low complexity region	681	701	N/A	INTRINSIC
SH3	750	808	4.28e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101562
AA Change: I418S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: I418S

Domain	Start	End	E-Value	Type
low complexity region	127	144	N/A	INTRINSIC
low complexity region	154	166	N/A	INTRINSIC
PH	309	402	2.31e-18	SMART
ArfGap	424	544	6.82e-27	SMART
ANK	587	619	6.17e-1	SMART
ANK	623	652	4.03e-5	SMART
ANK	656	686	1.48e3	SMART
low complexity region	696	710	N/A	INTRINSIC
low complexity region	768	792	N/A	INTRINSIC
low complexity region	830	850	N/A	INTRINSIC
SH3	899	957	4.28e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	A	9: 103,282,646	E22V	possibly damaging	Het
4930564D02Rik	G	T	3: 105,078,412	R47S	unknown	Het
4931408C20Rik	A	T	1: 26,684,467	L544Q	probably benign	Het
Abtb2	T	G	2: 103,567,412	I229S	probably damaging	Het
Adgre1	T	C	17: 57,420,441	L457P	probably damaging	Het
Amer3	C	A	1: 34,587,902	D407E	probably damaging	Het
Arhgap20	T	C	9: 51,849,035	S729P	probably benign	Het
Atp5j2	T	C	5: 145,188,485		probably null	Het
Brinp3	T	A	1: 146,902,086	V757E	probably benign	Het
Brip1	C	T	11: 86,139,103	G572R	probably benign	Het
C3	C	A	17: 57,223,215	R462L	probably benign	Het
Cat	T	A	2: 103,463,298	H395L	probably benign	Het
Cela3a	T	C	4: 137,402,606	N235D	possibly damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cntnap1	G	T	11: 101,185,268	G993W	probably damaging	Het
Col9a1	A	G	1: 24,179,403		probably null	Het
Coro2b	G	T	9: 62,489,372	H29N	probably benign	Het
Dll3	C	T	7: 28,299,111	R143H	probably damaging	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
Dync1i1	T	A	6: 5,784,530	*114R	probably null	Het
Ecm2	T	C	13: 49,515,078	S86P	probably damaging	Het
Eif5	T	C	12: 111,540,290		probably benign	Het
Ets1	T	A	9: 32,733,032		probably null	Het
Exph5	A	G	9: 53,375,896	N1426D	possibly damaging	Het
Eya2	T	C	2: 165,687,666	F110L	probably benign	Het
Flt1	T	A	5: 147,580,381	E1032V	probably damaging	Het
Galnt5	A	T	2: 58,017,193	H556L	probably benign	Het
Glb1l3	A	T	9: 26,829,003	Y344N	probably benign	Het
Glrx3	C	A	7: 137,459,286	D216E	possibly damaging	Het
Gm45871	T	A	18: 90,591,375	C246S	probably damaging	Het
Gm8251	G	T	1: 44,059,496	P814Q	probably damaging	Het
Gm906	T	C	13: 50,245,744	I849V	probably benign	Het
Gstm4	A	G	3: 108,042,373	L137P	probably benign	Het
Hsd17b13	T	C	5: 103,968,750	T169A	probably damaging	Het
Hydin	A	C	8: 110,600,362	T4778P	probably benign	Het
Ifna15	A	G	4: 88,557,983	L88P	probably damaging	Het
Kcnab1	G	A	3: 65,376,531	R390H	probably benign	Het
Kng1	C	A	16: 23,067,787	H161N	possibly damaging	Het
Lamp5	T	C	2: 136,060,958	V199A	probably benign	Het
Lrig3	G	A	10: 126,009,966	V755M	probably damaging	Het
Mad1l1	C	T	5: 140,144,044	R412H	probably damaging	Het
March6	C	A	15: 31,486,359	C350F	probably benign	Het
Mastl	A	G	2: 23,133,389	S441P	probably damaging	Het
Mfsd13b	A	T	7: 120,991,728	M231L	probably benign	Het
Micalcl	T	C	7: 112,382,151	V444A	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo15	A	G	11: 60,477,961	M516V	probably benign	Het
Myo1b	A	T	1: 51,751,254	F1110L	probably damaging	Het
Nbr1	T	A	11: 101,569,321	L381*	probably null	Het
Nln	T	C	13: 104,050,847	K325E	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Nrp2	C	T	1: 62,745,504	P271S	probably benign	Het
Obox6	A	C	7: 15,834,646	L102V	possibly damaging	Het
Olfr1008	T	C	2: 85,689,837	M136T	probably damaging	Het
Olfr1208	T	C	2: 88,897,271	I109V	possibly damaging	Het
Olfr1241	T	C	2: 89,482,455	S227G	probably benign	Het
Olfr853	A	G	9: 19,537,099	M277T	probably damaging	Het
Pde10a	A	G	17: 8,967,462	H567R	probably damaging	Het
Pdgfra	C	T	5: 75,183,098	S760L	possibly damaging	Het
Pid1	T	A	1: 84,159,129	I94L	unknown	Het
Plekhn1	T	C	4: 156,222,671	H474R	probably benign	Het
Prcc	A	T	3: 87,869,681	S329T	possibly damaging	Het
Pros1	G	T	16: 62,919,523	R445L	probably damaging	Het
Pxdn	C	A	12: 30,012,261	H1370Q	probably benign	Het
Sgce	T	A	6: 4,694,106	R283S	probably damaging	Het
Slc25a20	T	G	9: 108,682,458		probably null	Het
Slc6a1	T	C	6: 114,311,818	V446A	probably damaging	Het
Slc6a4	C	G	11: 77,017,085	Y358*	probably null	Het
Sned1	A	C	1: 93,281,736	E857A	probably damaging	Het
Spdye4b	C	T	5: 143,202,390	R213C	possibly damaging	Het
Spry2	T	G	14: 105,893,512	E80A	probably damaging	Het
Stard9	G	A	2: 120,666,534	C142Y	probably benign	Het
Sync	A	T	4: 129,294,306	Q377L	probably benign	Het
Tdrd12	A	G	7: 35,485,692	C718R		Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmbim1	T	C	1: 74,291,279	E185G	probably benign	Het
Tyk2	T	C	9: 21,108,034	M1031V	probably damaging	Het
Vmn1r71	C	T	7: 10,748,501	V87I	not run	Het
Vmn2r49	A	G	7: 9,986,814	V250A	probably benign	Het
Yipf3	A	C	17: 46,250,827	T187P	probably damaging	Het
Zfp148	G	T	16: 33,434,790	R50L	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Asap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Asap2	APN	12	21239648	missense	possibly damaging	0.66
IGL01140:Asap2	APN	12	21206316	missense	probably damaging	1.00
IGL01285:Asap2	APN	12	21229263	missense	probably damaging	1.00
IGL01318:Asap2	APN	12	21247295	missense	probably null	0.00
IGL01355:Asap2	APN	12	21218086	splice site	probably benign
IGL01593:Asap2	APN	12	21213202	missense	probably null	0.03
IGL01705:Asap2	APN	12	21249368	missense	possibly damaging	0.85
IGL01716:Asap2	APN	12	21254306	missense	possibly damaging	0.94
IGL02822:Asap2	APN	12	21265910	missense	probably damaging	1.00
IGL02876:Asap2	APN	12	21258163	missense	probably benign	0.00
IGL02991:Asap2	APN	12	21249293	splice site	probably benign
R0157:Asap2	UTSW	12	21206325	missense	probably damaging	1.00
R0399:Asap2	UTSW	12	21217997	missense	possibly damaging	0.90
R0472:Asap2	UTSW	12	21213185	missense	possibly damaging	0.47
R0959:Asap2	UTSW	12	21247319	missense	probably damaging	1.00
R0981:Asap2	UTSW	12	21265960	missense	probably damaging	0.98
R1141:Asap2	UTSW	12	21185110	missense	probably damaging	1.00
R1382:Asap2	UTSW	12	21265954	missense	probably damaging	1.00
R1418:Asap2	UTSW	12	21239585	missense	probably damaging	1.00
R1418:Asap2	UTSW	12	21239589	missense	probably damaging	1.00
R1469:Asap2	UTSW	12	21213179	missense	probably benign	0.00
R1469:Asap2	UTSW	12	21213179	missense	probably benign	0.00
R1526:Asap2	UTSW	12	21185187	missense	probably damaging	1.00
R1542:Asap2	UTSW	12	21265997	missense	probably damaging	1.00
R1710:Asap2	UTSW	12	21224392	missense	probably damaging	1.00
R1750:Asap2	UTSW	12	21203998	missense	probably damaging	1.00
R2151:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2152:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2154:Asap2	UTSW	12	21112083	missense	probably damaging	1.00
R2323:Asap2	UTSW	12	21203968	missense	probably damaging	1.00
R2378:Asap2	UTSW	12	21254318	missense	possibly damaging	0.95
R3151:Asap2	UTSW	12	21224377	missense	probably damaging	1.00
R3757:Asap2	UTSW	12	21267766	missense	probably damaging	1.00
R4305:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4307:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4308:Asap2	UTSW	12	21229481	missense	probably damaging	1.00
R4345:Asap2	UTSW	12	21230831	missense	probably damaging	1.00
R4525:Asap2	UTSW	12	21229292	splice site	probably null
R4562:Asap2	UTSW	12	21112093	missense	probably damaging	1.00
R4999:Asap2	UTSW	12	21252765	missense	probably benign	0.19
R5027:Asap2	UTSW	12	21204081	missense	probably damaging	1.00
R5221:Asap2	UTSW	12	21213190	missense	probably benign	0.14
R5645:Asap2	UTSW	12	21265982	missense	probably damaging	0.99
R5799:Asap2	UTSW	12	21168246	missense	probably damaging	1.00
R5876:Asap2	UTSW	12	21212809	missense	possibly damaging	0.88
R5888:Asap2	UTSW	12	21218190	missense	probably damaging	1.00
R5912:Asap2	UTSW	12	21206343	missense	probably damaging	1.00
R6576:Asap2	UTSW	12	21244703	missense	probably damaging	1.00
R6896:Asap2	UTSW	12	21265525	missense	probably damaging	1.00
R6934:Asap2	UTSW	12	21168250	missense	probably damaging	1.00
R7134:Asap2	UTSW	12	21265963	nonsense	probably null
R7378:Asap2	UTSW	12	21112051	missense	probably benign	0.01
R7515:Asap2	UTSW	12	21229239	missense	possibly damaging	0.76
R8033:Asap2	UTSW	12	21224389	missense	probably damaging	1.00
R8793:Asap2	UTSW	12	21168211	missense	probably damaging	1.00
R8891:Asap2	UTSW	12	21112143	missense	probably damaging	1.00
R8972:Asap2	UTSW	12	21229248	missense	probably damaging	1.00
R9021:Asap2	UTSW	12	21203998	missense	possibly damaging	0.94
R9216:Asap2	UTSW	12	21213190	missense	probably benign	0.14
R9323:Asap2	UTSW	12	21112147	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGACGTACCACTTCCAAGC -3'
(R):5'- AGCCCAGACTGCTTTGTACC -3'

Sequencing Primer
(F):5'- CAAGAATGTCAGATGTAAGTGCTGTG -3'
(R):5'- CCAAATGCCCTAGAGCTG -3'

Posted On

2019-09-13