Incidental Mutation 'R7347:Zfp148'
ID 570310
Institutional Source Beutler Lab
Gene Symbol Zfp148
Ensembl Gene ENSMUSG00000022811
Gene Name zinc finger protein 148
Synonyms 2210405J08Rik, ZBP-89, BFCOL1, BERF-1, beta enolase repressor factor 1
MMRRC Submission 045374-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7347 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 33201145-33324273 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 33255160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 50 (R50L)
Ref Sequence ENSEMBL: ENSMUSP00000087106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089677] [ENSMUST00000165418] [ENSMUST00000232023]
AlphaFold Q61624
Predicted Effect possibly damaging
Transcript: ENSMUST00000089677
AA Change: R50L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087106
Gene: ENSMUSG00000022811
AA Change: R50L

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165418
AA Change: R50L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126338
Gene: ENSMUSG00000022811
AA Change: R50L

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000232023
AA Change: R50L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel family of zinc finger DNA binding proteins. The encoded protein activates transcription of the T-cell receptor and intestinal alkaline phosphatase genes but represses transcription of the ornithine decarboxylase, vimentin, gastrin, stomelysin, and enolase genes. Increased expression of this gene results in decreased patient survival rates from colorectal cancer, while mutations in this gene have been associated with global developmental delay, hypoplastic corpus callosum, and dysmorphic facies. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption of one allele results in haploinsufficient male infertility in which chimeric males display a loss of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930564D02Rik G T 3: 104,985,728 (GRCm39) R47S unknown Het
Abtb2 T G 2: 103,397,757 (GRCm39) I229S probably damaging Het
Adgre1 T C 17: 57,727,441 (GRCm39) L457P probably damaging Het
Amer3 C A 1: 34,626,983 (GRCm39) D407E probably damaging Het
Arhgap20 T C 9: 51,760,335 (GRCm39) S729P probably benign Het
Asap2 T G 12: 21,279,458 (GRCm39) I418S probably benign Het
Atp5mf T C 5: 145,125,295 (GRCm39) probably null Het
Brinp3 T A 1: 146,777,824 (GRCm39) V757E probably benign Het
Brip1 C T 11: 86,029,929 (GRCm39) G572R probably benign Het
C3 C A 17: 57,530,215 (GRCm39) R462L probably benign Het
Cat T A 2: 103,293,643 (GRCm39) H395L probably benign Het
Ccdc168 G T 1: 44,098,656 (GRCm39) P814Q probably damaging Het
Cela3a T C 4: 137,129,917 (GRCm39) N235D possibly damaging Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cntnap1 G T 11: 101,076,094 (GRCm39) G993W probably damaging Het
Col9a1 A G 1: 24,218,484 (GRCm39) probably null Het
Coro2b G T 9: 62,396,654 (GRCm39) H29N probably benign Het
Dll3 C T 7: 27,998,536 (GRCm39) R143H probably damaging Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 (GRCm39) *114R probably null Het
Ecm2 T C 13: 49,668,554 (GRCm39) S86P probably damaging Het
Eif5 T C 12: 111,506,724 (GRCm39) probably benign Het
Ets1 T A 9: 32,644,328 (GRCm39) probably null Het
Exph5 A G 9: 53,287,196 (GRCm39) N1426D possibly damaging Het
Eya2 T C 2: 165,529,586 (GRCm39) F110L probably benign Het
Flt1 T A 5: 147,517,191 (GRCm39) E1032V probably damaging Het
Galnt5 A T 2: 57,907,205 (GRCm39) H556L probably benign Het
Glb1l3 A T 9: 26,740,299 (GRCm39) Y344N probably benign Het
Glrx3 C A 7: 137,061,015 (GRCm39) D216E possibly damaging Het
Gm45871 T A 18: 90,609,499 (GRCm39) C246S probably damaging Het
Gstm4 A G 3: 107,949,689 (GRCm39) L137P probably benign Het
Hsd17b13 T C 5: 104,116,616 (GRCm39) T169A probably damaging Het
Hydin A C 8: 111,326,994 (GRCm39) T4778P probably benign Het
Ifna15 A G 4: 88,476,220 (GRCm39) L88P probably damaging Het
Inhca T A 9: 103,159,845 (GRCm39) E22V possibly damaging Het
Kcnab1 G A 3: 65,283,952 (GRCm39) R390H probably benign Het
Kng1 C A 16: 22,886,537 (GRCm39) H161N possibly damaging Het
Lamp5 T C 2: 135,902,878 (GRCm39) V199A probably benign Het
Lrig3 G A 10: 125,845,835 (GRCm39) V755M probably damaging Het
Mad1l1 C T 5: 140,129,799 (GRCm39) R412H probably damaging Het
Marchf6 C A 15: 31,486,505 (GRCm39) C350F probably benign Het
Mastl A G 2: 23,023,401 (GRCm39) S441P probably damaging Het
Mfsd13b A T 7: 120,590,951 (GRCm39) M231L probably benign Het
Mical2 T C 7: 111,981,358 (GRCm39) V444A probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myo15a A G 11: 60,368,787 (GRCm39) M516V probably benign Het
Myo1b A T 1: 51,790,413 (GRCm39) F1110L probably damaging Het
Nbr1 T A 11: 101,460,147 (GRCm39) L381* probably null Het
Nln T C 13: 104,187,355 (GRCm39) K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 (GRCm39) S15A possibly damaging Het
Nrp2 C T 1: 62,784,663 (GRCm39) P271S probably benign Het
Obox6 A C 7: 15,568,571 (GRCm39) L102V possibly damaging Het
Or4a69 T C 2: 89,312,799 (GRCm39) S227G probably benign Het
Or4p8 T C 2: 88,727,615 (GRCm39) I109V possibly damaging Het
Or7g33 A G 9: 19,448,395 (GRCm39) M277T probably damaging Het
Or8k16 T C 2: 85,520,181 (GRCm39) M136T probably damaging Het
Pde10a A G 17: 9,186,294 (GRCm39) H567R probably damaging Het
Pdgfra C T 5: 75,343,759 (GRCm39) S760L possibly damaging Het
Pid1 T A 1: 84,136,850 (GRCm39) I94L unknown Het
Plekhn1 T C 4: 156,307,128 (GRCm39) H474R probably benign Het
Prcc A T 3: 87,776,988 (GRCm39) S329T possibly damaging Het
Pros1 G T 16: 62,739,886 (GRCm39) R445L probably damaging Het
Pxdn C A 12: 30,062,260 (GRCm39) H1370Q probably benign Het
Sgce T A 6: 4,694,106 (GRCm39) R283S probably damaging Het
Slc25a20 T G 9: 108,559,657 (GRCm39) probably null Het
Slc6a1 T C 6: 114,288,779 (GRCm39) V446A probably damaging Het
Slc6a4 C G 11: 76,907,911 (GRCm39) Y358* probably null Het
Sned1 A C 1: 93,209,458 (GRCm39) E857A probably damaging Het
Spata31e2 A T 1: 26,723,548 (GRCm39) L544Q probably benign Het
Spata31e3 T C 13: 50,399,780 (GRCm39) I849V probably benign Het
Spdye4b C T 5: 143,188,145 (GRCm39) R213C possibly damaging Het
Spry2 T G 14: 106,130,946 (GRCm39) E80A probably damaging Het
Stard9 G A 2: 120,497,015 (GRCm39) C142Y probably benign Het
Sync A T 4: 129,188,099 (GRCm39) Q377L probably benign Het
Tdrd12 A G 7: 35,185,117 (GRCm39) C718R Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmbim1 T C 1: 74,330,438 (GRCm39) E185G probably benign Het
Tyk2 T C 9: 21,019,330 (GRCm39) M1031V probably damaging Het
Vmn1r71 C T 7: 10,482,428 (GRCm39) V87I not run Het
Vmn2r49 A G 7: 9,720,741 (GRCm39) V250A probably benign Het
Yipf3 A C 17: 46,561,753 (GRCm39) T187P probably damaging Het
Zfp628 G A 7: 4,924,817 (GRCm39) G1013E probably damaging Het
Other mutations in Zfp148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Zfp148 APN 16 33,277,313 (GRCm39) missense probably benign
IGL02059:Zfp148 APN 16 33,316,933 (GRCm39) missense probably damaging 1.00
IGL02389:Zfp148 APN 16 33,315,816 (GRCm39) missense probably damaging 1.00
ANU22:Zfp148 UTSW 16 33,277,313 (GRCm39) missense probably benign
R0680:Zfp148 UTSW 16 33,316,174 (GRCm39) missense possibly damaging 0.74
R1455:Zfp148 UTSW 16 33,315,835 (GRCm39) critical splice donor site probably null
R2175:Zfp148 UTSW 16 33,317,116 (GRCm39) nonsense probably null
R2497:Zfp148 UTSW 16 33,316,755 (GRCm39) missense probably damaging 1.00
R4229:Zfp148 UTSW 16 33,255,133 (GRCm39) missense probably benign 0.00
R4470:Zfp148 UTSW 16 33,316,602 (GRCm39) missense probably damaging 0.98
R4687:Zfp148 UTSW 16 33,317,189 (GRCm39) missense probably damaging 1.00
R4693:Zfp148 UTSW 16 33,288,505 (GRCm39) missense probably damaging 1.00
R4701:Zfp148 UTSW 16 33,277,278 (GRCm39) missense probably benign 0.00
R5272:Zfp148 UTSW 16 33,316,594 (GRCm39) missense probably damaging 0.99
R5479:Zfp148 UTSW 16 33,317,589 (GRCm39) missense probably damaging 0.99
R5511:Zfp148 UTSW 16 33,255,004 (GRCm39) start gained probably benign
R5679:Zfp148 UTSW 16 33,316,156 (GRCm39) missense probably damaging 1.00
R5798:Zfp148 UTSW 16 33,316,513 (GRCm39) missense probably benign 0.03
R6142:Zfp148 UTSW 16 33,315,829 (GRCm39) missense possibly damaging 0.63
R6368:Zfp148 UTSW 16 33,317,568 (GRCm39) missense probably damaging 0.99
R6866:Zfp148 UTSW 16 33,288,496 (GRCm39) missense probably damaging 1.00
R7419:Zfp148 UTSW 16 33,317,511 (GRCm39) missense possibly damaging 0.87
R7709:Zfp148 UTSW 16 33,288,545 (GRCm39) missense probably damaging 0.99
R8771:Zfp148 UTSW 16 33,317,656 (GRCm39) missense possibly damaging 0.67
R9120:Zfp148 UTSW 16 33,317,596 (GRCm39) missense probably benign 0.00
R9528:Zfp148 UTSW 16 33,316,660 (GRCm39) missense probably benign 0.27
R9591:Zfp148 UTSW 16 33,315,737 (GRCm39) missense
Z1177:Zfp148 UTSW 16 33,317,169 (GRCm39) missense probably damaging 0.99
Z1177:Zfp148 UTSW 16 33,316,839 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCCTCTGGAAGTCAATCTTGG -3'
(R):5'- TACTGCAGTCCTTGGGGAAG -3'

Sequencing Primer
(F):5'- CAAACTTGGTCTTTCTAGGCAG -3'
(R):5'- TCCTTGGGGAAGCCGCTC -3'
Posted On 2019-09-13