Incidental Mutation 'R7347:Zfp148'
ID570310
Institutional Source Beutler Lab
Gene Symbol Zfp148
Ensembl Gene ENSMUSG00000022811
Gene Namezinc finger protein 148
SynonymsZBP-89, BFCOL1, BERF-1, beta enolase repressor factor 1, 2210405J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7347 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location33380836-33504363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33434790 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 50 (R50L)
Ref Sequence ENSEMBL: ENSMUSP00000087106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089677] [ENSMUST00000165418] [ENSMUST00000232023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089677
AA Change: R50L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087106
Gene: ENSMUSG00000022811
AA Change: R50L

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165418
AA Change: R50L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126338
Gene: ENSMUSG00000022811
AA Change: R50L

DomainStartEndE-ValueType
low complexity region 141 149 N/A INTRINSIC
ZnF_C2H2 171 193 4.4e-2 SMART
ZnF_C2H2 199 221 2.09e-3 SMART
ZnF_C2H2 227 249 2.24e-3 SMART
ZnF_C2H2 255 278 4.57e0 SMART
low complexity region 314 323 N/A INTRINSIC
low complexity region 328 344 N/A INTRINSIC
low complexity region 589 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000232023
AA Change: R50L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel family of zinc finger DNA binding proteins. The encoded protein activates transcription of the T-cell receptor and intestinal alkaline phosphatase genes but represses transcription of the ornithine decarboxylase, vimentin, gastrin, stomelysin, and enolase genes. Increased expression of this gene results in decreased patient survival rates from colorectal cancer, while mutations in this gene have been associated with global developmental delay, hypoplastic corpus callosum, and dysmorphic facies. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption of one allele results in haploinsufficient male infertility in which chimeric males display a loss of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,282,646 E22V possibly damaging Het
4930564D02Rik G T 3: 105,078,412 R47S unknown Het
4931408C20Rik A T 1: 26,684,467 L544Q probably benign Het
Abtb2 T G 2: 103,567,412 I229S probably damaging Het
Adgre1 T C 17: 57,420,441 L457P probably damaging Het
Amer3 C A 1: 34,587,902 D407E probably damaging Het
Arhgap20 T C 9: 51,849,035 S729P probably benign Het
Asap2 T G 12: 21,229,457 I418S probably benign Het
Atp5j2 T C 5: 145,188,485 probably null Het
Brinp3 T A 1: 146,902,086 V757E probably benign Het
Brip1 C T 11: 86,139,103 G572R probably benign Het
C3 C A 17: 57,223,215 R462L probably benign Het
Cat T A 2: 103,463,298 H395L probably benign Het
Cela3a T C 4: 137,402,606 N235D possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cntnap1 G T 11: 101,185,268 G993W probably damaging Het
Col9a1 A G 1: 24,179,403 probably null Het
Coro2b G T 9: 62,489,372 H29N probably benign Het
Dll3 C T 7: 28,299,111 R143H probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 *114R probably null Het
Ecm2 T C 13: 49,515,078 S86P probably damaging Het
Eif5 T C 12: 111,540,290 probably benign Het
Ets1 T A 9: 32,733,032 probably null Het
Exph5 A G 9: 53,375,896 N1426D possibly damaging Het
Eya2 T C 2: 165,687,666 F110L probably benign Het
Flt1 T A 5: 147,580,381 E1032V probably damaging Het
Galnt5 A T 2: 58,017,193 H556L probably benign Het
Glb1l3 A T 9: 26,829,003 Y344N probably benign Het
Glrx3 C A 7: 137,459,286 D216E possibly damaging Het
Gm45871 T A 18: 90,591,375 C246S probably damaging Het
Gm8251 G T 1: 44,059,496 P814Q probably damaging Het
Gm906 T C 13: 50,245,744 I849V probably benign Het
Gstm4 A G 3: 108,042,373 L137P probably benign Het
Hsd17b13 T C 5: 103,968,750 T169A probably damaging Het
Hydin A C 8: 110,600,362 T4778P probably benign Het
Ifna15 A G 4: 88,557,983 L88P probably damaging Het
Kcnab1 G A 3: 65,376,531 R390H probably benign Het
Kng1 C A 16: 23,067,787 H161N possibly damaging Het
Lamp5 T C 2: 136,060,958 V199A probably benign Het
Lrig3 G A 10: 126,009,966 V755M probably damaging Het
Mad1l1 C T 5: 140,144,044 R412H probably damaging Het
March6 C A 15: 31,486,359 C350F probably benign Het
Mastl A G 2: 23,133,389 S441P probably damaging Het
Mfsd13b A T 7: 120,991,728 M231L probably benign Het
Micalcl T C 7: 112,382,151 V444A probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 A G 11: 60,477,961 M516V probably benign Het
Myo1b A T 1: 51,751,254 F1110L probably damaging Het
Nbr1 T A 11: 101,569,321 L381* probably null Het
Nln T C 13: 104,050,847 K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Nrp2 C T 1: 62,745,504 P271S probably benign Het
Obox6 A C 7: 15,834,646 L102V possibly damaging Het
Olfr1008 T C 2: 85,689,837 M136T probably damaging Het
Olfr1208 T C 2: 88,897,271 I109V possibly damaging Het
Olfr1241 T C 2: 89,482,455 S227G probably benign Het
Olfr853 A G 9: 19,537,099 M277T probably damaging Het
Pde10a A G 17: 8,967,462 H567R probably damaging Het
Pdgfra C T 5: 75,183,098 S760L possibly damaging Het
Pid1 T A 1: 84,159,129 I94L unknown Het
Plekhn1 T C 4: 156,222,671 H474R probably benign Het
Prcc A T 3: 87,869,681 S329T possibly damaging Het
Pros1 G T 16: 62,919,523 R445L probably damaging Het
Pxdn C A 12: 30,012,261 H1370Q probably benign Het
Sgce T A 6: 4,694,106 R283S probably damaging Het
Slc25a20 T G 9: 108,682,458 probably null Het
Slc6a1 T C 6: 114,311,818 V446A probably damaging Het
Slc6a4 C G 11: 77,017,085 Y358* probably null Het
Sned1 A C 1: 93,281,736 E857A probably damaging Het
Spdye4b C T 5: 143,202,390 R213C possibly damaging Het
Spry2 T G 14: 105,893,512 E80A probably damaging Het
Stard9 G A 2: 120,666,534 C142Y probably benign Het
Sync A T 4: 129,294,306 Q377L probably benign Het
Tdrd12 A G 7: 35,485,692 C718R Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmbim1 T C 1: 74,291,279 E185G probably benign Het
Tyk2 T C 9: 21,108,034 M1031V probably damaging Het
Vmn1r71 C T 7: 10,748,501 V87I not run Het
Vmn2r49 A G 7: 9,986,814 V250A probably benign Het
Yipf3 A C 17: 46,250,827 T187P probably damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Zfp148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Zfp148 APN 16 33456943 missense probably benign
IGL02059:Zfp148 APN 16 33496563 missense probably damaging 1.00
IGL02389:Zfp148 APN 16 33495446 missense probably damaging 1.00
ANU22:Zfp148 UTSW 16 33456943 missense probably benign
R0680:Zfp148 UTSW 16 33495804 missense possibly damaging 0.74
R1455:Zfp148 UTSW 16 33495465 critical splice donor site probably null
R2175:Zfp148 UTSW 16 33496746 nonsense probably null
R2497:Zfp148 UTSW 16 33496385 missense probably damaging 1.00
R4229:Zfp148 UTSW 16 33434763 missense probably benign 0.00
R4470:Zfp148 UTSW 16 33496232 missense probably damaging 0.98
R4687:Zfp148 UTSW 16 33496819 missense probably damaging 1.00
R4693:Zfp148 UTSW 16 33468135 missense probably damaging 1.00
R4701:Zfp148 UTSW 16 33456908 missense probably benign 0.00
R5272:Zfp148 UTSW 16 33496224 missense probably damaging 0.99
R5479:Zfp148 UTSW 16 33497219 missense probably damaging 0.99
R5511:Zfp148 UTSW 16 33434634 start gained probably benign
R5679:Zfp148 UTSW 16 33495786 missense probably damaging 1.00
R5798:Zfp148 UTSW 16 33496143 missense probably benign 0.03
R6142:Zfp148 UTSW 16 33495459 missense possibly damaging 0.63
R6368:Zfp148 UTSW 16 33497198 missense probably damaging 0.99
R6866:Zfp148 UTSW 16 33468126 missense probably damaging 1.00
R7419:Zfp148 UTSW 16 33497141 missense possibly damaging 0.87
R7709:Zfp148 UTSW 16 33468175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCTCTGGAAGTCAATCTTGG -3'
(R):5'- TACTGCAGTCCTTGGGGAAG -3'

Sequencing Primer
(F):5'- CAAACTTGGTCTTTCTAGGCAG -3'
(R):5'- TCCTTGGGGAAGCCGCTC -3'
Posted On2019-09-13