Incidental Mutation 'R7347:Pros1'
ID 570311
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission
Accession Numbers

Genbank: NM_011173; MGI: 1095733  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7347 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 62854307-62929346 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 62919523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 445 (R445L)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably damaging
Transcript: ENSMUST00000023629
AA Change: R445L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: R445L

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Meta Mutation Damage Score 0.8181 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,282,646 E22V possibly damaging Het
4930564D02Rik G T 3: 105,078,412 R47S unknown Het
4931408C20Rik A T 1: 26,684,467 L544Q probably benign Het
Abtb2 T G 2: 103,567,412 I229S probably damaging Het
Adgre1 T C 17: 57,420,441 L457P probably damaging Het
Amer3 C A 1: 34,587,902 D407E probably damaging Het
Arhgap20 T C 9: 51,849,035 S729P probably benign Het
Asap2 T G 12: 21,229,457 I418S probably benign Het
Atp5j2 T C 5: 145,188,485 probably null Het
Brinp3 T A 1: 146,902,086 V757E probably benign Het
Brip1 C T 11: 86,139,103 G572R probably benign Het
C3 C A 17: 57,223,215 R462L probably benign Het
Cat T A 2: 103,463,298 H395L probably benign Het
Cela3a T C 4: 137,402,606 N235D possibly damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cntnap1 G T 11: 101,185,268 G993W probably damaging Het
Col9a1 A G 1: 24,179,403 probably null Het
Coro2b G T 9: 62,489,372 H29N probably benign Het
Dll3 C T 7: 28,299,111 R143H probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 *114R probably null Het
Ecm2 T C 13: 49,515,078 S86P probably damaging Het
Eif5 T C 12: 111,540,290 probably benign Het
Ets1 T A 9: 32,733,032 probably null Het
Exph5 A G 9: 53,375,896 N1426D possibly damaging Het
Eya2 T C 2: 165,687,666 F110L probably benign Het
Flt1 T A 5: 147,580,381 E1032V probably damaging Het
Galnt5 A T 2: 58,017,193 H556L probably benign Het
Glb1l3 A T 9: 26,829,003 Y344N probably benign Het
Glrx3 C A 7: 137,459,286 D216E possibly damaging Het
Gm45871 T A 18: 90,591,375 C246S probably damaging Het
Gm8251 G T 1: 44,059,496 P814Q probably damaging Het
Gm906 T C 13: 50,245,744 I849V probably benign Het
Gstm4 A G 3: 108,042,373 L137P probably benign Het
Hsd17b13 T C 5: 103,968,750 T169A probably damaging Het
Hydin A C 8: 110,600,362 T4778P probably benign Het
Ifna15 A G 4: 88,557,983 L88P probably damaging Het
Kcnab1 G A 3: 65,376,531 R390H probably benign Het
Kng1 C A 16: 23,067,787 H161N possibly damaging Het
Lamp5 T C 2: 136,060,958 V199A probably benign Het
Lrig3 G A 10: 126,009,966 V755M probably damaging Het
Mad1l1 C T 5: 140,144,044 R412H probably damaging Het
March6 C A 15: 31,486,359 C350F probably benign Het
Mastl A G 2: 23,133,389 S441P probably damaging Het
Mfsd13b A T 7: 120,991,728 M231L probably benign Het
Micalcl T C 7: 112,382,151 V444A probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 A G 11: 60,477,961 M516V probably benign Het
Myo1b A T 1: 51,751,254 F1110L probably damaging Het
Nbr1 T A 11: 101,569,321 L381* probably null Het
Nln T C 13: 104,050,847 K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Nrp2 C T 1: 62,745,504 P271S probably benign Het
Obox6 A C 7: 15,834,646 L102V possibly damaging Het
Olfr1008 T C 2: 85,689,837 M136T probably damaging Het
Olfr1208 T C 2: 88,897,271 I109V possibly damaging Het
Olfr1241 T C 2: 89,482,455 S227G probably benign Het
Olfr853 A G 9: 19,537,099 M277T probably damaging Het
Pde10a A G 17: 8,967,462 H567R probably damaging Het
Pdgfra C T 5: 75,183,098 S760L possibly damaging Het
Pid1 T A 1: 84,159,129 I94L unknown Het
Plekhn1 T C 4: 156,222,671 H474R probably benign Het
Prcc A T 3: 87,869,681 S329T possibly damaging Het
Pxdn C A 12: 30,012,261 H1370Q probably benign Het
Sgce T A 6: 4,694,106 R283S probably damaging Het
Slc25a20 T G 9: 108,682,458 probably null Het
Slc6a1 T C 6: 114,311,818 V446A probably damaging Het
Slc6a4 C G 11: 77,017,085 Y358* probably null Het
Sned1 A C 1: 93,281,736 E857A probably damaging Het
Spdye4b C T 5: 143,202,390 R213C possibly damaging Het
Spry2 T G 14: 105,893,512 E80A probably damaging Het
Stard9 G A 2: 120,666,534 C142Y probably benign Het
Sync A T 4: 129,294,306 Q377L probably benign Het
Tdrd12 A G 7: 35,485,692 C718R Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmbim1 T C 1: 74,291,279 E185G probably benign Het
Tyk2 T C 9: 21,108,034 M1031V probably damaging Het
Vmn1r71 C T 7: 10,748,501 V87I not run Het
Vmn2r49 A G 7: 9,986,814 V250A probably benign Het
Yipf3 A C 17: 46,250,827 T187P probably damaging Het
Zfp148 G T 16: 33,434,790 R50L possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62903518 missense probably benign 0.03
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1308:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62913848 missense probably damaging 0.99
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62900645 nonsense probably null
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7055:Pros1 UTSW 16 62928102 missense possibly damaging 0.85
R7375:Pros1 UTSW 16 62924550 missense probably damaging 0.96
R7419:Pros1 UTSW 16 62928070 nonsense probably null
R7980:Pros1 UTSW 16 62928153 missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62928177 missense possibly damaging 0.73
R8479:Pros1 UTSW 16 62907739 missense probably damaging 1.00
R8514:Pros1 UTSW 16 62910109 missense probably benign 0.03
R8827:Pros1 UTSW 16 62926464 missense probably benign 0.13
R9131:Pros1 UTSW 16 62928034 missense probably damaging 0.96
R9484:Pros1 UTSW 16 62924524 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCATCAGGACCCAACTGCAG -3'
(R):5'- CAGGATTCACTTACTGTAGTCTATGC -3'

Sequencing Primer
(F):5'- GCAGTGGCATAGTCTCAGTTTAC -3'
(R):5'- TGCTGAACTGAGCAATTCCG -3'
Posted On 2019-09-13