Incidental Mutation 'R7347:C3'
ID 570314
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Name complement component 3
Synonyms Plp, acylation stimulating protein, complement factor 3
MMRRC Submission 045374-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7347 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 57510970-57535136 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 57530215 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 462 (R462L)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
AlphaFold P01027
Predicted Effect probably benign
Transcript: ENSMUST00000024988
AA Change: R462L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: R462L

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930564D02Rik G T 3: 104,985,728 (GRCm39) R47S unknown Het
Abtb2 T G 2: 103,397,757 (GRCm39) I229S probably damaging Het
Adgre1 T C 17: 57,727,441 (GRCm39) L457P probably damaging Het
Amer3 C A 1: 34,626,983 (GRCm39) D407E probably damaging Het
Arhgap20 T C 9: 51,760,335 (GRCm39) S729P probably benign Het
Asap2 T G 12: 21,279,458 (GRCm39) I418S probably benign Het
Atp5mf T C 5: 145,125,295 (GRCm39) probably null Het
Brinp3 T A 1: 146,777,824 (GRCm39) V757E probably benign Het
Brip1 C T 11: 86,029,929 (GRCm39) G572R probably benign Het
Cat T A 2: 103,293,643 (GRCm39) H395L probably benign Het
Ccdc168 G T 1: 44,098,656 (GRCm39) P814Q probably damaging Het
Cela3a T C 4: 137,129,917 (GRCm39) N235D possibly damaging Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cntnap1 G T 11: 101,076,094 (GRCm39) G993W probably damaging Het
Col9a1 A G 1: 24,218,484 (GRCm39) probably null Het
Coro2b G T 9: 62,396,654 (GRCm39) H29N probably benign Het
Dll3 C T 7: 27,998,536 (GRCm39) R143H probably damaging Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 (GRCm39) *114R probably null Het
Ecm2 T C 13: 49,668,554 (GRCm39) S86P probably damaging Het
Eif5 T C 12: 111,506,724 (GRCm39) probably benign Het
Ets1 T A 9: 32,644,328 (GRCm39) probably null Het
Exph5 A G 9: 53,287,196 (GRCm39) N1426D possibly damaging Het
Eya2 T C 2: 165,529,586 (GRCm39) F110L probably benign Het
Flt1 T A 5: 147,517,191 (GRCm39) E1032V probably damaging Het
Galnt5 A T 2: 57,907,205 (GRCm39) H556L probably benign Het
Glb1l3 A T 9: 26,740,299 (GRCm39) Y344N probably benign Het
Glrx3 C A 7: 137,061,015 (GRCm39) D216E possibly damaging Het
Gm45871 T A 18: 90,609,499 (GRCm39) C246S probably damaging Het
Gstm4 A G 3: 107,949,689 (GRCm39) L137P probably benign Het
Hsd17b13 T C 5: 104,116,616 (GRCm39) T169A probably damaging Het
Hydin A C 8: 111,326,994 (GRCm39) T4778P probably benign Het
Ifna15 A G 4: 88,476,220 (GRCm39) L88P probably damaging Het
Inhca T A 9: 103,159,845 (GRCm39) E22V possibly damaging Het
Kcnab1 G A 3: 65,283,952 (GRCm39) R390H probably benign Het
Kng1 C A 16: 22,886,537 (GRCm39) H161N possibly damaging Het
Lamp5 T C 2: 135,902,878 (GRCm39) V199A probably benign Het
Lrig3 G A 10: 125,845,835 (GRCm39) V755M probably damaging Het
Mad1l1 C T 5: 140,129,799 (GRCm39) R412H probably damaging Het
Marchf6 C A 15: 31,486,505 (GRCm39) C350F probably benign Het
Mastl A G 2: 23,023,401 (GRCm39) S441P probably damaging Het
Mfsd13b A T 7: 120,590,951 (GRCm39) M231L probably benign Het
Mical2 T C 7: 111,981,358 (GRCm39) V444A probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myo15a A G 11: 60,368,787 (GRCm39) M516V probably benign Het
Myo1b A T 1: 51,790,413 (GRCm39) F1110L probably damaging Het
Nbr1 T A 11: 101,460,147 (GRCm39) L381* probably null Het
Nln T C 13: 104,187,355 (GRCm39) K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 (GRCm39) S15A possibly damaging Het
Nrp2 C T 1: 62,784,663 (GRCm39) P271S probably benign Het
Obox6 A C 7: 15,568,571 (GRCm39) L102V possibly damaging Het
Or4a69 T C 2: 89,312,799 (GRCm39) S227G probably benign Het
Or4p8 T C 2: 88,727,615 (GRCm39) I109V possibly damaging Het
Or7g33 A G 9: 19,448,395 (GRCm39) M277T probably damaging Het
Or8k16 T C 2: 85,520,181 (GRCm39) M136T probably damaging Het
Pde10a A G 17: 9,186,294 (GRCm39) H567R probably damaging Het
Pdgfra C T 5: 75,343,759 (GRCm39) S760L possibly damaging Het
Pid1 T A 1: 84,136,850 (GRCm39) I94L unknown Het
Plekhn1 T C 4: 156,307,128 (GRCm39) H474R probably benign Het
Prcc A T 3: 87,776,988 (GRCm39) S329T possibly damaging Het
Pros1 G T 16: 62,739,886 (GRCm39) R445L probably damaging Het
Pxdn C A 12: 30,062,260 (GRCm39) H1370Q probably benign Het
Sgce T A 6: 4,694,106 (GRCm39) R283S probably damaging Het
Slc25a20 T G 9: 108,559,657 (GRCm39) probably null Het
Slc6a1 T C 6: 114,288,779 (GRCm39) V446A probably damaging Het
Slc6a4 C G 11: 76,907,911 (GRCm39) Y358* probably null Het
Sned1 A C 1: 93,209,458 (GRCm39) E857A probably damaging Het
Spata31e2 A T 1: 26,723,548 (GRCm39) L544Q probably benign Het
Spata31e3 T C 13: 50,399,780 (GRCm39) I849V probably benign Het
Spdye4b C T 5: 143,188,145 (GRCm39) R213C possibly damaging Het
Spry2 T G 14: 106,130,946 (GRCm39) E80A probably damaging Het
Stard9 G A 2: 120,497,015 (GRCm39) C142Y probably benign Het
Sync A T 4: 129,188,099 (GRCm39) Q377L probably benign Het
Tdrd12 A G 7: 35,185,117 (GRCm39) C718R Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmbim1 T C 1: 74,330,438 (GRCm39) E185G probably benign Het
Tyk2 T C 9: 21,019,330 (GRCm39) M1031V probably damaging Het
Vmn1r71 C T 7: 10,482,428 (GRCm39) V87I not run Het
Vmn2r49 A G 7: 9,720,741 (GRCm39) V250A probably benign Het
Yipf3 A C 17: 46,561,753 (GRCm39) T187P probably damaging Het
Zfp148 G T 16: 33,255,160 (GRCm39) R50L possibly damaging Het
Zfp628 G A 7: 4,924,817 (GRCm39) G1013E probably damaging Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57,533,004 (GRCm39) missense probably benign 0.01
IGL00741:C3 APN 17 57,527,206 (GRCm39) intron probably benign
IGL01093:C3 APN 17 57,530,949 (GRCm39) missense probably damaging 1.00
IGL01309:C3 APN 17 57,516,652 (GRCm39) intron probably benign
IGL01312:C3 APN 17 57,532,993 (GRCm39) unclassified probably benign
IGL01344:C3 APN 17 57,531,880 (GRCm39) missense probably benign
IGL01514:C3 APN 17 57,522,866 (GRCm39) missense probably benign 0.04
IGL01913:C3 APN 17 57,520,767 (GRCm39) missense probably null 0.01
IGL02165:C3 APN 17 57,532,092 (GRCm39) missense probably benign 0.17
IGL02176:C3 APN 17 57,533,337 (GRCm39) unclassified probably benign
IGL02189:C3 APN 17 57,527,113 (GRCm39) missense probably benign 0.01
IGL02378:C3 APN 17 57,519,698 (GRCm39) missense probably benign 0.19
IGL02422:C3 APN 17 57,533,823 (GRCm39) missense probably damaging 0.98
IGL02715:C3 APN 17 57,511,158 (GRCm39) intron probably benign
IGL02737:C3 APN 17 57,511,281 (GRCm39) missense probably benign 0.08
IGL03201:C3 APN 17 57,529,249 (GRCm39) missense probably damaging 1.00
IGL03210:C3 APN 17 57,522,846 (GRCm39) nonsense probably null
IGL03345:C3 APN 17 57,526,585 (GRCm39) missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57,513,242 (GRCm39) missense probably benign 0.00
PIT4494001:C3 UTSW 17 57,516,263 (GRCm39) missense probably benign 0.01
R0158:C3 UTSW 17 57,531,851 (GRCm39) critical splice donor site probably null
R0318:C3 UTSW 17 57,531,709 (GRCm39) missense probably damaging 0.99
R1132:C3 UTSW 17 57,514,531 (GRCm39) critical splice donor site probably null
R1765:C3 UTSW 17 57,531,401 (GRCm39) splice site probably null
R1793:C3 UTSW 17 57,526,592 (GRCm39) missense possibly damaging 0.93
R1852:C3 UTSW 17 57,529,823 (GRCm39) missense probably damaging 0.98
R1908:C3 UTSW 17 57,516,489 (GRCm39) missense probably damaging 1.00
R1919:C3 UTSW 17 57,527,135 (GRCm39) missense probably damaging 1.00
R1935:C3 UTSW 17 57,525,829 (GRCm39) missense probably damaging 1.00
R2026:C3 UTSW 17 57,525,562 (GRCm39) missense probably damaging 1.00
R2108:C3 UTSW 17 57,530,974 (GRCm39) splice site probably null
R2197:C3 UTSW 17 57,526,623 (GRCm39) missense probably benign 0.32
R2394:C3 UTSW 17 57,529,303 (GRCm39) nonsense probably null
R2998:C3 UTSW 17 57,517,284 (GRCm39) missense probably benign 0.00
R3727:C3 UTSW 17 57,514,379 (GRCm39) missense possibly damaging 0.50
R3767:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R3768:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R3769:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R3770:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R3784:C3 UTSW 17 57,533,067 (GRCm39) missense probably damaging 0.99
R3883:C3 UTSW 17 57,524,173 (GRCm39) critical splice acceptor site probably null
R3884:C3 UTSW 17 57,524,173 (GRCm39) critical splice acceptor site probably null
R3950:C3 UTSW 17 57,532,286 (GRCm39) missense probably benign 0.02
R3966:C3 UTSW 17 57,525,664 (GRCm39) missense probably damaging 0.99
R4077:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R4078:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R4079:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R4168:C3 UTSW 17 57,525,608 (GRCm39) missense probably benign 0.00
R4208:C3 UTSW 17 57,512,303 (GRCm39) missense possibly damaging 0.96
R4695:C3 UTSW 17 57,528,057 (GRCm39) missense probably benign
R4909:C3 UTSW 17 57,533,830 (GRCm39) critical splice donor site probably null
R5011:C3 UTSW 17 57,530,236 (GRCm39) missense probably benign 0.06
R5094:C3 UTSW 17 57,532,033 (GRCm39) critical splice donor site probably null
R5141:C3 UTSW 17 57,526,570 (GRCm39) missense probably damaging 0.98
R5170:C3 UTSW 17 57,530,938 (GRCm39) missense probably damaging 0.96
R5339:C3 UTSW 17 57,531,308 (GRCm39) missense probably damaging 0.99
R5369:C3 UTSW 17 57,528,159 (GRCm39) missense probably benign 0.45
R5412:C3 UTSW 17 57,527,187 (GRCm39) missense probably benign 0.01
R5439:C3 UTSW 17 57,511,502 (GRCm39) missense probably benign 0.28
R5463:C3 UTSW 17 57,518,720 (GRCm39) missense probably benign 0.08
R5546:C3 UTSW 17 57,529,976 (GRCm39) missense probably damaging 0.99
R5572:C3 UTSW 17 57,531,673 (GRCm39) missense probably damaging 0.99
R5851:C3 UTSW 17 57,518,612 (GRCm39) missense probably null 0.14
R5863:C3 UTSW 17 57,530,141 (GRCm39) missense probably benign 0.06
R5888:C3 UTSW 17 57,521,831 (GRCm39) missense probably damaging 1.00
R5940:C3 UTSW 17 57,517,244 (GRCm39) missense possibly damaging 0.64
R6073:C3 UTSW 17 57,513,223 (GRCm39) missense probably null
R6091:C3 UTSW 17 57,528,967 (GRCm39) nonsense probably null
R6286:C3 UTSW 17 57,531,118 (GRCm39) missense probably damaging 1.00
R6524:C3 UTSW 17 57,524,264 (GRCm39) critical splice donor site probably null
R6868:C3 UTSW 17 57,511,029 (GRCm39) missense possibly damaging 0.55
R6896:C3 UTSW 17 57,527,864 (GRCm39) splice site probably null
R7007:C3 UTSW 17 57,525,809 (GRCm39) missense probably benign 0.00
R7022:C3 UTSW 17 57,524,286 (GRCm39) missense probably damaging 1.00
R7099:C3 UTSW 17 57,513,276 (GRCm39) missense probably benign 0.28
R7117:C3 UTSW 17 57,519,655 (GRCm39) missense probably benign 0.01
R7366:C3 UTSW 17 57,528,162 (GRCm39) missense probably benign 0.00
R7423:C3 UTSW 17 57,521,767 (GRCm39) missense probably damaging 1.00
R7425:C3 UTSW 17 57,511,039 (GRCm39) missense possibly damaging 0.81
R7481:C3 UTSW 17 57,527,136 (GRCm39) missense probably damaging 1.00
R7540:C3 UTSW 17 57,513,220 (GRCm39) missense probably benign 0.01
R7746:C3 UTSW 17 57,525,859 (GRCm39) missense probably damaging 1.00
R7771:C3 UTSW 17 57,522,797 (GRCm39) missense probably damaging 1.00
R7884:C3 UTSW 17 57,533,264 (GRCm39) missense probably benign 0.05
R8144:C3 UTSW 17 57,533,276 (GRCm39) missense probably damaging 0.98
R8279:C3 UTSW 17 57,522,809 (GRCm39) missense probably benign 0.28
R8284:C3 UTSW 17 57,530,938 (GRCm39) missense probably benign 0.39
R8328:C3 UTSW 17 57,527,973 (GRCm39) missense probably benign 0.00
R8353:C3 UTSW 17 57,519,643 (GRCm39) missense probably benign 0.00
R8396:C3 UTSW 17 57,528,029 (GRCm39) missense probably benign
R8429:C3 UTSW 17 57,529,811 (GRCm39) missense probably damaging 1.00
R8453:C3 UTSW 17 57,519,643 (GRCm39) missense probably benign 0.00
R8557:C3 UTSW 17 57,531,383 (GRCm39) missense probably benign 0.00
R8738:C3 UTSW 17 57,511,015 (GRCm39) makesense probably null
R8794:C3 UTSW 17 57,528,011 (GRCm39) missense probably benign
R9130:C3 UTSW 17 57,518,678 (GRCm39) missense probably damaging 1.00
R9296:C3 UTSW 17 57,511,291 (GRCm39) missense probably benign
R9432:C3 UTSW 17 57,530,950 (GRCm39) missense probably damaging 1.00
R9451:C3 UTSW 17 57,531,169 (GRCm39) missense probably benign 0.03
R9542:C3 UTSW 17 57,532,037 (GRCm39) missense probably damaging 1.00
R9615:C3 UTSW 17 57,518,669 (GRCm39) missense probably damaging 1.00
R9624:C3 UTSW 17 57,527,189 (GRCm39) missense probably benign 0.00
Z1177:C3 UTSW 17 57,533,171 (GRCm39) missense probably damaging 0.99
Z1177:C3 UTSW 17 57,524,144 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TAGAATGGGTACAGGAGACCCC -3'
(R):5'- TTTTCATGACACCTCCGTGG -3'

Sequencing Primer
(F):5'- CAGGGCTGGGCATGAATC -3'
(R):5'- ATCACAGACCCTGTTGTGAG -3'
Posted On 2019-09-13