Mutagenetix > Incidental Mutations

Incidental Mutation 'R7348:Ap4e1'

570323

Institutional Source

Beutler Lab

Gene Symbol

Ap4e1

Ensembl Gene

ENSMUSG00000001998

Gene Name

adaptor-related protein complex AP-4, epsilon 1

Synonyms

2310033A20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R7348 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127008717-127067909 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 127061977 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 933 (S933I)

Ref Sequence

ENSEMBL: ENSMUSP00000002063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000142740] [ENSMUST00000177372]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002063
AA Change: S933I

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998
AA Change: S933I

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	600	5.9e-90	PFAM
low complexity region	841	853	N/A	INTRINSIC
AP4E_app_platf	1017	1120	4.2e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142740

Predicted Effect

probably benign
Transcript: ENSMUST00000177372

SMART Domains

Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	51	291	2.5e-47	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abra	G	A	15: 41,866,159	R282C	probably damaging	Het
Adcy2	T	A	13: 68,734,675	E314D	possibly damaging	Het
Adgrl2	A	T	3: 148,817,766	I274N		Het
Adpgk	A	G	9: 59,313,786	I292V	probably benign	Het
Agtrap	G	T	4: 148,080,597	F124L	probably benign	Het
Ankrd26	A	G	6: 118,508,564	Y1450H	probably damaging	Het
Ap5s1	A	T	2: 131,212,652	T128S	possibly damaging	Het
Arih1	T	C	9: 59,486,058	Y97C	probably damaging	Het
Atp1a3	A	G	7: 24,978,826	F1034S	unknown	Het
Bmp6	T	C	13: 38,485,903	S388P	probably benign	Het
Ccdc39	A	G	3: 33,832,676	V261A	possibly damaging	Het
Ccdc66	C	T	14: 27,500,336	C150Y	probably damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cln6	A	G	9: 62,849,176	S201G	probably benign	Het
Cntnap4	T	C	8: 112,665,277	Y125H	probably damaging	Het
Copa	A	G	1: 172,102,223	T286A	possibly damaging	Het
Cul9	A	T	17: 46,510,993	I1852K	possibly damaging	Het
Cyp2j8	C	A	4: 96,444,640	A490S	probably benign	Het
Cyp2t4	A	G	7: 27,157,251	I239V	probably benign	Het
E2f7	C	T	10: 110,780,975	T692I	probably damaging	Het
Fastkd5	A	G	2: 130,615,135	Y512H	probably damaging	Het
Fastkd5	A	C	2: 130,616,439	M77R	probably benign	Het
Fhod3	A	G	18: 25,090,467	R957G	possibly damaging	Het
Gm17018	A	G	19: 45,572,466	Y111C	probably damaging	Het
H6pd	C	A	4: 149,983,902		probably null	Het
Haus5	G	T	7: 30,656,966	P544Q	possibly damaging	Het
Ifi207	CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG	CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG	1: 173,729,196		probably benign	Het
Igf2r	A	G	17: 12,703,484	Y1248H	probably damaging	Het
Izumo3	T	C	4: 92,147,218	N6S	possibly damaging	Het
Lrp6	G	T	6: 134,450,818	P1604T	probably damaging	Het
Map3k8	T	A	18: 4,340,561	H251L	probably damaging	Het
Mapre3	T	C	5: 30,861,829	Y6H	probably benign	Het
Mlh3	G	T	12: 85,267,441	P657Q	probably damaging	Het
Mrgpra1	T	C	7: 47,335,409	Y174C	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myh1	C	A	11: 67,202,539	P152Q	probably damaging	Het
Myh6	A	T	14: 54,952,259	L1110Q	probably damaging	Het
Nf1	T	A	11: 79,536,850	S1778T	probably benign	Het
Nkpd1	G	A	7: 19,524,416	E707K	probably damaging	Het
Nlrp4a	A	G	7: 26,444,273	E21G	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Olfr1354	A	G	10: 78,917,562	T241A	probably damaging	Het
Olfr453	T	C	6: 42,744,856	L273S	possibly damaging	Het
Olfr488	T	C	7: 108,256,123	D5G	probably benign	Het
Olfr491	T	C	7: 108,317,713	V273A	possibly damaging	Het
Parg	G	A	14: 32,250,079	R677Q	possibly damaging	Het
Pcsk5	A	T	19: 17,456,818	C1395*	probably null	Het
Psd2	G	A	18: 35,980,336	S287N	possibly damaging	Het
Psd3	T	C	8: 67,790,931	N685S	possibly damaging	Het
Pygb	C	T	2: 150,786,983	T39M	probably benign	Het
Rbfox1	C	A	16: 7,408,024	Y351*	probably null	Het
Rftn1	A	G	17: 50,004,323	L396P	probably damaging	Het
S1pr1	A	G	3: 115,712,061	Y295H	probably damaging	Het
Scn5a	T	C	9: 119,535,833	M440V	probably benign	Het
Sel1l2	T	C	2: 140,265,724	N240S	probably benign	Het
Skint1	T	C	4: 112,021,573	L234P	probably damaging	Het
Skint11	T	A	4: 114,244,722	Y311N	probably benign	Het
Slc6a5	A	T	7: 49,910,167		probably benign	Het
Tas2r134	T	C	2: 51,628,402	S298P	possibly damaging	Het
Tbcd	C	A	11: 121,594,311	A773D	probably benign	Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmem184a	T	C	5: 139,814,054	E24G	probably null	Het
Tmem207	C	A	16: 26,516,827	W53C	possibly damaging	Het
Tns1	T	A	1: 73,916,917	H549L	possibly damaging	Het
Ttc37	T	C	13: 76,182,884	F1478L	possibly damaging	Het
Ttc41	G	T	10: 86,750,348	E839*	probably null	Het
Ufd1	T	G	16: 18,815,885		probably benign	Het
Usp28	A	G	9: 49,030,877	E713G	probably benign	Het
Utrn	A	G	10: 12,748,018	W159R	probably damaging	Het
Vcl	C	T	14: 21,003,150	A411V	probably benign	Het
Vcl	T	A	14: 21,008,952	C545*	probably null	Het
Vmn1r120	A	T	7: 21,053,452	S111R	probably damaging	Het
Wwox	T	A	8: 114,472,652	C146S	probably benign	Het
Zbtb2	T	C	10: 4,374,574	T57A	possibly damaging	Het
Zfp362	T	C	4: 128,777,217	D336G	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het
Zfp704	A	G	3: 9,474,598	S231P	probably damaging	Het
Zhx3	G	T	2: 160,782,118	S43*	probably null	Het

Other mutations in Ap4e1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ap4e1	APN	2	127028281	missense	probably damaging	1.00
IGL00423:Ap4e1	APN	2	127028289	missense	probably damaging	0.99
IGL00659:Ap4e1	APN	2	127063301	missense	probably benign	0.30
IGL01155:Ap4e1	APN	2	127043445	missense	probably damaging	1.00
IGL01672:Ap4e1	APN	2	127052189	missense	probably damaging	1.00
IGL01866:Ap4e1	APN	2	127046910	missense	possibly damaging	0.83
IGL01940:Ap4e1	APN	2	127043511	missense	probably damaging	0.97
IGL02131:Ap4e1	APN	2	127061929	missense	probably benign
IGL02207:Ap4e1	APN	2	127011816	missense	probably damaging	1.00
IGL03394:Ap4e1	APN	2	127063397	missense	probably benign	0.18
quickstep	UTSW	2	127008902	critical splice donor site	probably null
K7371:Ap4e1	UTSW	2	127066536	unclassified	probably benign
R0090:Ap4e1	UTSW	2	127064985	missense	possibly damaging	0.70
R0420:Ap4e1	UTSW	2	127049360	missense	probably damaging	1.00
R0490:Ap4e1	UTSW	2	127046186	missense	probably damaging	1.00
R0632:Ap4e1	UTSW	2	127049280	nonsense	probably null
R0670:Ap4e1	UTSW	2	127011864	critical splice donor site	probably null
R0698:Ap4e1	UTSW	2	127063363	missense	probably benign	0.00
R1183:Ap4e1	UTSW	2	127014201	missense	probably damaging	0.98
R1338:Ap4e1	UTSW	2	127046909	missense	probably damaging	1.00
R1513:Ap4e1	UTSW	2	127061555	missense	probably null	1.00
R1528:Ap4e1	UTSW	2	127011823	missense	possibly damaging	0.50
R1994:Ap4e1	UTSW	2	127061547	missense	probably benign	0.00
R2270:Ap4e1	UTSW	2	127047163	critical splice donor site	probably null
R2271:Ap4e1	UTSW	2	127047163	critical splice donor site	probably null
R3108:Ap4e1	UTSW	2	127056306	critical splice donor site	probably null
R4019:Ap4e1	UTSW	2	127061926	missense	probably benign	0.01
R4020:Ap4e1	UTSW	2	127061926	missense	probably benign	0.01
R4454:Ap4e1	UTSW	2	127047141	missense	probably damaging	1.00
R4691:Ap4e1	UTSW	2	127061871	missense	probably benign	0.08
R4767:Ap4e1	UTSW	2	127060438	missense	probably benign
R4803:Ap4e1	UTSW	2	127049559	missense	probably benign	0.20
R4804:Ap4e1	UTSW	2	127043758	critical splice donor site	probably null
R5155:Ap4e1	UTSW	2	127063369	missense	probably benign	0.02
R5157:Ap4e1	UTSW	2	127061695	missense	probably benign	0.00
R5248:Ap4e1	UTSW	2	127064922	missense	possibly damaging	0.95
R5363:Ap4e1	UTSW	2	127037864	splice site	probably null
R5507:Ap4e1	UTSW	2	127008898	missense	probably damaging	0.98
R5642:Ap4e1	UTSW	2	127064979	missense	possibly damaging	0.67
R6122:Ap4e1	UTSW	2	127028160	splice site	probably null
R6180:Ap4e1	UTSW	2	127066588	nonsense	probably null
R6298:Ap4e1	UTSW	2	127047115	missense	probably benign	0.00
R6329:Ap4e1	UTSW	2	127061716	missense	probably benign	0.10
R6543:Ap4e1	UTSW	2	127066605	missense	probably benign	0.03
R6954:Ap4e1	UTSW	2	127064951	missense	probably benign	0.01
R7144:Ap4e1	UTSW	2	127011807	missense	probably damaging	0.99
R7165:Ap4e1	UTSW	2	127063318	missense	possibly damaging	0.48
R7348:Ap4e1	UTSW	2	127061976	missense	probably damaging	0.96
R7382:Ap4e1	UTSW	2	127008902	critical splice donor site	probably null
R7571:Ap4e1	UTSW	2	127019336	missense	probably damaging	1.00
R7768:Ap4e1	UTSW	2	127046934	missense	probably damaging	1.00
X0060:Ap4e1	UTSW	2	127063410	missense	probably benign	0.01
X0065:Ap4e1	UTSW	2	127061650	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAGTGTCAGCTTGCCTGTG -3'
(R):5'- CTCTAGAGTAATGTATCCTGAGTCC -3'

Sequencing Primer
(F):5'- TTGCTGATAACAACATGGAAGTC -3'
(R):5'- CCTGAGTCCTGTTTTTAAGGAAGAC -3'

Posted On

2019-09-13