Incidental Mutation 'R7348:Ap4e1'
ID570323
Institutional Source Beutler Lab
Gene Symbol Ap4e1
Ensembl Gene ENSMUSG00000001998
Gene Nameadaptor-related protein complex AP-4, epsilon 1
Synonyms2310033A20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7348 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127008717-127067909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127061977 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 933 (S933I)
Ref Sequence ENSEMBL: ENSMUSP00000002063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000142740] [ENSMUST00000177372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002063
AA Change: S933I

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998
AA Change: S933I

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 600 5.9e-90 PFAM
low complexity region 841 853 N/A INTRINSIC
AP4E_app_platf 1017 1120 4.2e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142740
Predicted Effect probably benign
Transcript: ENSMUST00000177372
SMART Domains Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 291 2.5e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra G A 15: 41,866,159 R282C probably damaging Het
Adcy2 T A 13: 68,734,675 E314D possibly damaging Het
Adgrl2 A T 3: 148,817,766 I274N Het
Adpgk A G 9: 59,313,786 I292V probably benign Het
Agtrap G T 4: 148,080,597 F124L probably benign Het
Ankrd26 A G 6: 118,508,564 Y1450H probably damaging Het
Ap5s1 A T 2: 131,212,652 T128S possibly damaging Het
Arih1 T C 9: 59,486,058 Y97C probably damaging Het
Atp1a3 A G 7: 24,978,826 F1034S unknown Het
Bmp6 T C 13: 38,485,903 S388P probably benign Het
Ccdc39 A G 3: 33,832,676 V261A possibly damaging Het
Ccdc66 C T 14: 27,500,336 C150Y probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cln6 A G 9: 62,849,176 S201G probably benign Het
Cntnap4 T C 8: 112,665,277 Y125H probably damaging Het
Copa A G 1: 172,102,223 T286A possibly damaging Het
Cul9 A T 17: 46,510,993 I1852K possibly damaging Het
Cyp2j8 C A 4: 96,444,640 A490S probably benign Het
Cyp2t4 A G 7: 27,157,251 I239V probably benign Het
E2f7 C T 10: 110,780,975 T692I probably damaging Het
Fastkd5 A G 2: 130,615,135 Y512H probably damaging Het
Fastkd5 A C 2: 130,616,439 M77R probably benign Het
Fhod3 A G 18: 25,090,467 R957G possibly damaging Het
Gm17018 A G 19: 45,572,466 Y111C probably damaging Het
H6pd C A 4: 149,983,902 probably null Het
Haus5 G T 7: 30,656,966 P544Q possibly damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Igf2r A G 17: 12,703,484 Y1248H probably damaging Het
Izumo3 T C 4: 92,147,218 N6S possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Map3k8 T A 18: 4,340,561 H251L probably damaging Het
Mapre3 T C 5: 30,861,829 Y6H probably benign Het
Mlh3 G T 12: 85,267,441 P657Q probably damaging Het
Mrgpra1 T C 7: 47,335,409 Y174C probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh1 C A 11: 67,202,539 P152Q probably damaging Het
Myh6 A T 14: 54,952,259 L1110Q probably damaging Het
Nf1 T A 11: 79,536,850 S1778T probably benign Het
Nkpd1 G A 7: 19,524,416 E707K probably damaging Het
Nlrp4a A G 7: 26,444,273 E21G probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1354 A G 10: 78,917,562 T241A probably damaging Het
Olfr453 T C 6: 42,744,856 L273S possibly damaging Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr491 T C 7: 108,317,713 V273A possibly damaging Het
Parg G A 14: 32,250,079 R677Q possibly damaging Het
Pcsk5 A T 19: 17,456,818 C1395* probably null Het
Psd2 G A 18: 35,980,336 S287N possibly damaging Het
Psd3 T C 8: 67,790,931 N685S possibly damaging Het
Pygb C T 2: 150,786,983 T39M probably benign Het
Rbfox1 C A 16: 7,408,024 Y351* probably null Het
Rftn1 A G 17: 50,004,323 L396P probably damaging Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Scn5a T C 9: 119,535,833 M440V probably benign Het
Sel1l2 T C 2: 140,265,724 N240S probably benign Het
Skint1 T C 4: 112,021,573 L234P probably damaging Het
Skint11 T A 4: 114,244,722 Y311N probably benign Het
Slc6a5 A T 7: 49,910,167 probably benign Het
Tas2r134 T C 2: 51,628,402 S298P possibly damaging Het
Tbcd C A 11: 121,594,311 A773D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmem184a T C 5: 139,814,054 E24G probably null Het
Tmem207 C A 16: 26,516,827 W53C possibly damaging Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Ttc37 T C 13: 76,182,884 F1478L possibly damaging Het
Ttc41 G T 10: 86,750,348 E839* probably null Het
Ufd1 T G 16: 18,815,885 probably benign Het
Usp28 A G 9: 49,030,877 E713G probably benign Het
Utrn A G 10: 12,748,018 W159R probably damaging Het
Vcl C T 14: 21,003,150 A411V probably benign Het
Vcl T A 14: 21,008,952 C545* probably null Het
Vmn1r120 A T 7: 21,053,452 S111R probably damaging Het
Wwox T A 8: 114,472,652 C146S probably benign Het
Zbtb2 T C 10: 4,374,574 T57A possibly damaging Het
Zfp362 T C 4: 128,777,217 D336G possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Zfp704 A G 3: 9,474,598 S231P probably damaging Het
Zhx3 G T 2: 160,782,118 S43* probably null Het
Other mutations in Ap4e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ap4e1 APN 2 127028281 missense probably damaging 1.00
IGL00423:Ap4e1 APN 2 127028289 missense probably damaging 0.99
IGL00659:Ap4e1 APN 2 127063301 missense probably benign 0.30
IGL01155:Ap4e1 APN 2 127043445 missense probably damaging 1.00
IGL01672:Ap4e1 APN 2 127052189 missense probably damaging 1.00
IGL01866:Ap4e1 APN 2 127046910 missense possibly damaging 0.83
IGL01940:Ap4e1 APN 2 127043511 missense probably damaging 0.97
IGL02131:Ap4e1 APN 2 127061929 missense probably benign
IGL02207:Ap4e1 APN 2 127011816 missense probably damaging 1.00
IGL03394:Ap4e1 APN 2 127063397 missense probably benign 0.18
quickstep UTSW 2 127008902 critical splice donor site probably null
K7371:Ap4e1 UTSW 2 127066536 unclassified probably benign
R0090:Ap4e1 UTSW 2 127064985 missense possibly damaging 0.70
R0420:Ap4e1 UTSW 2 127049360 missense probably damaging 1.00
R0490:Ap4e1 UTSW 2 127046186 missense probably damaging 1.00
R0632:Ap4e1 UTSW 2 127049280 nonsense probably null
R0670:Ap4e1 UTSW 2 127011864 critical splice donor site probably null
R0698:Ap4e1 UTSW 2 127063363 missense probably benign 0.00
R1183:Ap4e1 UTSW 2 127014201 missense probably damaging 0.98
R1338:Ap4e1 UTSW 2 127046909 missense probably damaging 1.00
R1513:Ap4e1 UTSW 2 127061555 missense probably null 1.00
R1528:Ap4e1 UTSW 2 127011823 missense possibly damaging 0.50
R1994:Ap4e1 UTSW 2 127061547 missense probably benign 0.00
R2270:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R2271:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R3108:Ap4e1 UTSW 2 127056306 critical splice donor site probably null
R4019:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4020:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4454:Ap4e1 UTSW 2 127047141 missense probably damaging 1.00
R4691:Ap4e1 UTSW 2 127061871 missense probably benign 0.08
R4767:Ap4e1 UTSW 2 127060438 missense probably benign
R4803:Ap4e1 UTSW 2 127049559 missense probably benign 0.20
R4804:Ap4e1 UTSW 2 127043758 critical splice donor site probably null
R5155:Ap4e1 UTSW 2 127063369 missense probably benign 0.02
R5157:Ap4e1 UTSW 2 127061695 missense probably benign 0.00
R5248:Ap4e1 UTSW 2 127064922 missense possibly damaging 0.95
R5363:Ap4e1 UTSW 2 127037864 splice site probably null
R5507:Ap4e1 UTSW 2 127008898 missense probably damaging 0.98
R5642:Ap4e1 UTSW 2 127064979 missense possibly damaging 0.67
R6122:Ap4e1 UTSW 2 127028160 splice site probably null
R6180:Ap4e1 UTSW 2 127066588 nonsense probably null
R6298:Ap4e1 UTSW 2 127047115 missense probably benign 0.00
R6329:Ap4e1 UTSW 2 127061716 missense probably benign 0.10
R6543:Ap4e1 UTSW 2 127066605 missense probably benign 0.03
R6954:Ap4e1 UTSW 2 127064951 missense probably benign 0.01
R7144:Ap4e1 UTSW 2 127011807 missense probably damaging 0.99
R7165:Ap4e1 UTSW 2 127063318 missense possibly damaging 0.48
R7348:Ap4e1 UTSW 2 127061976 missense probably damaging 0.96
R7382:Ap4e1 UTSW 2 127008902 critical splice donor site probably null
R7571:Ap4e1 UTSW 2 127019336 missense probably damaging 1.00
R7768:Ap4e1 UTSW 2 127046934 missense probably damaging 1.00
X0060:Ap4e1 UTSW 2 127063410 missense probably benign 0.01
X0065:Ap4e1 UTSW 2 127061650 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGTGTCAGCTTGCCTGTG -3'
(R):5'- CTCTAGAGTAATGTATCCTGAGTCC -3'

Sequencing Primer
(F):5'- TTGCTGATAACAACATGGAAGTC -3'
(R):5'- CCTGAGTCCTGTTTTTAAGGAAGAC -3'
Posted On2019-09-13