Incidental Mutation 'R7348:Adgrl2'
ID570333
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Nameadhesion G protein-coupled receptor L2
SynonymsLec1, Lphn2, Lphh1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7348 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location148815583-148990555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148817766 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 274 (I274N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000168352] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
Predicted Effect probably damaging
Transcript: ENSMUST00000106128
AA Change: I1291N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: I1291N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168352
AA Change: I43N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132116
Gene: ENSMUSG00000028184
AA Change: I43N

DomainStartEndE-ValueType
Pfam:Latrophilin 1 239 2.5e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195988
AA Change: I1239N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: I1239N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196526
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197348
Predicted Effect probably damaging
Transcript: ENSMUST00000197567
AA Change: I1291N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: I1291N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000198779
AA Change: I1256N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: I1256N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199059
AA Change: I1271N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: I1271N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199238
AA Change: I1282N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: I1282N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199750
AA Change: I1145N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: I1145N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200154
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200216
Predicted Effect probably benign
Transcript: ENSMUST00000200456
Predicted Effect probably damaging
Transcript: ENSMUST00000200543
AA Change: I1207N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: I1207N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Meta Mutation Damage Score 0.7941 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra G A 15: 41,866,159 R282C probably damaging Het
Adcy2 T A 13: 68,734,675 E314D possibly damaging Het
Adpgk A G 9: 59,313,786 I292V probably benign Het
Agtrap G T 4: 148,080,597 F124L probably benign Het
Ankrd26 A G 6: 118,508,564 Y1450H probably damaging Het
Ap4e1 A T 2: 127,061,976 S933C probably damaging Het
Ap4e1 G T 2: 127,061,977 S933I possibly damaging Het
Ap5s1 A T 2: 131,212,652 T128S possibly damaging Het
Arih1 T C 9: 59,486,058 Y97C probably damaging Het
Atp1a3 A G 7: 24,978,826 F1034S unknown Het
Bmp6 T C 13: 38,485,903 S388P probably benign Het
Ccdc39 A G 3: 33,832,676 V261A possibly damaging Het
Ccdc66 C T 14: 27,500,336 C150Y probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cln6 A G 9: 62,849,176 S201G probably benign Het
Cntnap4 T C 8: 112,665,277 Y125H probably damaging Het
Copa A G 1: 172,102,223 T286A possibly damaging Het
Cul9 A T 17: 46,510,993 I1852K possibly damaging Het
Cyp2j8 C A 4: 96,444,640 A490S probably benign Het
Cyp2t4 A G 7: 27,157,251 I239V probably benign Het
E2f7 C T 10: 110,780,975 T692I probably damaging Het
Fastkd5 A G 2: 130,615,135 Y512H probably damaging Het
Fastkd5 A C 2: 130,616,439 M77R probably benign Het
Fhod3 A G 18: 25,090,467 R957G possibly damaging Het
Gm17018 A G 19: 45,572,466 Y111C probably damaging Het
H6pd C A 4: 149,983,902 probably null Het
Haus5 G T 7: 30,656,966 P544Q possibly damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Igf2r A G 17: 12,703,484 Y1248H probably damaging Het
Izumo3 T C 4: 92,147,218 N6S possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Map3k8 T A 18: 4,340,561 H251L probably damaging Het
Mapre3 T C 5: 30,861,829 Y6H probably benign Het
Mlh3 G T 12: 85,267,441 P657Q probably damaging Het
Mrgpra1 T C 7: 47,335,409 Y174C probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh1 C A 11: 67,202,539 P152Q probably damaging Het
Myh6 A T 14: 54,952,259 L1110Q probably damaging Het
Nf1 T A 11: 79,536,850 S1778T probably benign Het
Nkpd1 G A 7: 19,524,416 E707K probably damaging Het
Nlrp4a A G 7: 26,444,273 E21G probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1354 A G 10: 78,917,562 T241A probably damaging Het
Olfr453 T C 6: 42,744,856 L273S possibly damaging Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr491 T C 7: 108,317,713 V273A possibly damaging Het
Parg G A 14: 32,250,079 R677Q possibly damaging Het
Pcsk5 A T 19: 17,456,818 C1395* probably null Het
Psd2 G A 18: 35,980,336 S287N possibly damaging Het
Psd3 T C 8: 67,790,931 N685S possibly damaging Het
Pygb C T 2: 150,786,983 T39M probably benign Het
Rbfox1 C A 16: 7,408,024 Y351* probably null Het
Rftn1 A G 17: 50,004,323 L396P probably damaging Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Scn5a T C 9: 119,535,833 M440V probably benign Het
Sel1l2 T C 2: 140,265,724 N240S probably benign Het
Skint1 T C 4: 112,021,573 L234P probably damaging Het
Skint11 T A 4: 114,244,722 Y311N probably benign Het
Slc6a5 A T 7: 49,910,167 probably benign Het
Tas2r134 T C 2: 51,628,402 S298P possibly damaging Het
Tbcd C A 11: 121,594,311 A773D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmem184a T C 5: 139,814,054 E24G probably null Het
Tmem207 C A 16: 26,516,827 W53C possibly damaging Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Ttc37 T C 13: 76,182,884 F1478L possibly damaging Het
Ttc41 G T 10: 86,750,348 E839* probably null Het
Ufd1 T G 16: 18,815,885 probably benign Het
Usp28 A G 9: 49,030,877 E713G probably benign Het
Utrn A G 10: 12,748,018 W159R probably damaging Het
Vcl C T 14: 21,003,150 A411V probably benign Het
Vcl T A 14: 21,008,952 C545* probably null Het
Vmn1r120 A T 7: 21,053,452 S111R probably damaging Het
Wwox T A 8: 114,472,652 C146S probably benign Het
Zbtb2 T C 10: 4,374,574 T57A possibly damaging Het
Zfp362 T C 4: 128,777,217 D336G possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Zfp704 A G 3: 9,474,598 S231P probably damaging Het
Zhx3 G T 2: 160,782,118 S43* probably null Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148865608 missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148826498 missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148836527 missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148858975 missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148828489 nonsense probably null
IGL02468:Adgrl2 APN 3 148890480 missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148826525 missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148890605 missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148817400 missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148859380 missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148859063 missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148817298 missense
PIT4544001:Adgrl2 UTSW 3 148890521 missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148852863 splice site probably benign
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0344:Adgrl2 UTSW 3 148865595 splice site probably null
R0488:Adgrl2 UTSW 3 148846905 missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148859218 missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148839244 missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148837679 missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148822981 missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148859273 missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148852762 missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148865608 missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148852593 missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148817244 missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148826475 missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148851934 missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148817649 missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148817551 missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148858963 missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148817235 missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148839152 missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148859020 missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148890463 missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148823036 missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148823713 missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148817844 missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148837562 critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148859164 missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148859175 missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148823009 missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148858942 missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148826507 missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148817286 missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148846929 missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148858949 missense probably damaging 1.00
R7326:Adgrl2 UTSW 3 148846870 missense probably benign 0.00
R7382:Adgrl2 UTSW 3 148817283 missense
R7486:Adgrl2 UTSW 3 148817694 missense
R7498:Adgrl2 UTSW 3 148859216 nonsense probably null
R7644:Adgrl2 UTSW 3 148839153 missense probably damaging 1.00
R7690:Adgrl2 UTSW 3 148817298 missense
R7742:Adgrl2 UTSW 3 148836428 missense probably damaging 1.00
R7745:Adgrl2 UTSW 3 148836458 missense probably damaging 1.00
RF007:Adgrl2 UTSW 3 148839248 missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148852654 missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148865594 splice site probably null
Predicted Primers PCR Primer
(F):5'- TACAGAAGCGAGTGAGTCCG -3'
(R):5'- GCCCTTTTCTGTTGCAGGAC -3'

Sequencing Primer
(F):5'- CAGCTCTTTGTGGCGGAACTC -3'
(R):5'- CTGTTGCAGGACATTCACTGAAC -3'
Posted On2019-09-13