Incidental Mutation 'R7348:Cntnap4'
ID570360
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Namecontactin associated protein-like 4
SynonymsE130114F09Rik, Caspr4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7348 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location112570043-112882717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112665277 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 125 (Y125H)
Ref Sequence ENSEMBL: ENSMUSP00000034225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
Predicted Effect probably damaging
Transcript: ENSMUST00000034225
AA Change: Y125H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: Y125H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118171
AA Change: Y125H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: Y125H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra G A 15: 41,866,159 R282C probably damaging Het
Adcy2 T A 13: 68,734,675 E314D possibly damaging Het
Adgrl2 A T 3: 148,817,766 I274N Het
Adpgk A G 9: 59,313,786 I292V probably benign Het
Agtrap G T 4: 148,080,597 F124L probably benign Het
Ankrd26 A G 6: 118,508,564 Y1450H probably damaging Het
Ap4e1 A T 2: 127,061,976 S933C probably damaging Het
Ap4e1 G T 2: 127,061,977 S933I possibly damaging Het
Ap5s1 A T 2: 131,212,652 T128S possibly damaging Het
Arih1 T C 9: 59,486,058 Y97C probably damaging Het
Atp1a3 A G 7: 24,978,826 F1034S unknown Het
Bmp6 T C 13: 38,485,903 S388P probably benign Het
Ccdc39 A G 3: 33,832,676 V261A possibly damaging Het
Ccdc66 C T 14: 27,500,336 C150Y probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cln6 A G 9: 62,849,176 S201G probably benign Het
Copa A G 1: 172,102,223 T286A possibly damaging Het
Cul9 A T 17: 46,510,993 I1852K possibly damaging Het
Cyp2j8 C A 4: 96,444,640 A490S probably benign Het
Cyp2t4 A G 7: 27,157,251 I239V probably benign Het
E2f7 C T 10: 110,780,975 T692I probably damaging Het
Fastkd5 A G 2: 130,615,135 Y512H probably damaging Het
Fastkd5 A C 2: 130,616,439 M77R probably benign Het
Fhod3 A G 18: 25,090,467 R957G possibly damaging Het
Gm17018 A G 19: 45,572,466 Y111C probably damaging Het
H6pd C A 4: 149,983,902 probably null Het
Haus5 G T 7: 30,656,966 P544Q possibly damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Igf2r A G 17: 12,703,484 Y1248H probably damaging Het
Izumo3 T C 4: 92,147,218 N6S possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Map3k8 T A 18: 4,340,561 H251L probably damaging Het
Mapre3 T C 5: 30,861,829 Y6H probably benign Het
Mlh3 G T 12: 85,267,441 P657Q probably damaging Het
Mrgpra1 T C 7: 47,335,409 Y174C probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh1 C A 11: 67,202,539 P152Q probably damaging Het
Myh6 A T 14: 54,952,259 L1110Q probably damaging Het
Nf1 T A 11: 79,536,850 S1778T probably benign Het
Nkpd1 G A 7: 19,524,416 E707K probably damaging Het
Nlrp4a A G 7: 26,444,273 E21G probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1354 A G 10: 78,917,562 T241A probably damaging Het
Olfr453 T C 6: 42,744,856 L273S possibly damaging Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr491 T C 7: 108,317,713 V273A possibly damaging Het
Parg G A 14: 32,250,079 R677Q possibly damaging Het
Pcsk5 A T 19: 17,456,818 C1395* probably null Het
Psd2 G A 18: 35,980,336 S287N possibly damaging Het
Psd3 T C 8: 67,790,931 N685S possibly damaging Het
Pygb C T 2: 150,786,983 T39M probably benign Het
Rbfox1 C A 16: 7,408,024 Y351* probably null Het
Rftn1 A G 17: 50,004,323 L396P probably damaging Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Scn5a T C 9: 119,535,833 M440V probably benign Het
Sel1l2 T C 2: 140,265,724 N240S probably benign Het
Skint1 T C 4: 112,021,573 L234P probably damaging Het
Skint11 T A 4: 114,244,722 Y311N probably benign Het
Slc6a5 A T 7: 49,910,167 probably benign Het
Tas2r134 T C 2: 51,628,402 S298P possibly damaging Het
Tbcd C A 11: 121,594,311 A773D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmem184a T C 5: 139,814,054 E24G probably null Het
Tmem207 C A 16: 26,516,827 W53C possibly damaging Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Ttc37 T C 13: 76,182,884 F1478L possibly damaging Het
Ttc41 G T 10: 86,750,348 E839* probably null Het
Ufd1 T G 16: 18,815,885 probably benign Het
Usp28 A G 9: 49,030,877 E713G probably benign Het
Utrn A G 10: 12,748,018 W159R probably damaging Het
Vcl C T 14: 21,003,150 A411V probably benign Het
Vcl T A 14: 21,008,952 C545* probably null Het
Vmn1r120 A T 7: 21,053,452 S111R probably damaging Het
Wwox T A 8: 114,472,652 C146S probably benign Het
Zbtb2 T C 10: 4,374,574 T57A possibly damaging Het
Zfp362 T C 4: 128,777,217 D336G possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Zfp704 A G 3: 9,474,598 S231P probably damaging Het
Zhx3 G T 2: 160,782,118 S43* probably null Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 112767619 splice site probably benign
IGL01898:Cntnap4 APN 8 112856307 missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 112752234 missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 112616494 missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 112785903 splice site probably benign
IGL02621:Cntnap4 APN 8 112810723 missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 112773590 missense probably benign 0.06
IGL03327:Cntnap4 APN 8 112773576 missense probably benign 0.00
IGL03346:Cntnap4 APN 8 112773576 missense probably benign 0.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 112785784 missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 112842516 critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 112856511 nonsense probably null
R0497:Cntnap4 UTSW 8 112570151 missense probably benign 0.00
R1495:Cntnap4 UTSW 8 112881763 missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 112881830 missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 112757523 missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 112815496 missense probably benign 0.10
R2160:Cntnap4 UTSW 8 112757571 missense probably damaging 1.00
R2226:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 112757439 missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R3917:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R4097:Cntnap4 UTSW 8 112752307 missense probably benign 0.03
R4348:Cntnap4 UTSW 8 112753922 missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 112665266 missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 112858210 missense probably benign 0.32
R4531:Cntnap4 UTSW 8 112810608 missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 112810710 missense probably benign
R4611:Cntnap4 UTSW 8 112773739 critical splice donor site probably null
R4675:Cntnap4 UTSW 8 112785836 missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 112733438 missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 112841753 missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 112875429 missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 112842721 missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 112803211 missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 112752289 missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 112757473 missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 112803226 missense probably benign 0.03
R7031:Cntnap4 UTSW 8 112858242 missense probably benign 0.01
R7107:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 112810636 missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 112881800 missense probably benign 0.05
R7232:Cntnap4 UTSW 8 112665099 splice site probably null
R7482:Cntnap4 UTSW 8 112733562 critical splice donor site probably null
R7832:Cntnap4 UTSW 8 112757481 missense probably benign
R7895:Cntnap4 UTSW 8 112752197 missense probably damaging 0.99
R7915:Cntnap4 UTSW 8 112757481 missense probably benign
R7978:Cntnap4 UTSW 8 112752197 missense probably damaging 0.99
R8014:Cntnap4 UTSW 8 112753945 missense not run
X0025:Cntnap4 UTSW 8 112859143 missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 112875579 missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 112815520 missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 112858189 missense not run
Predicted Primers PCR Primer
(F):5'- CCTGGAAGTCGTTCTGAATCCC -3'
(R):5'- GATTTAGCCATGAATAGCTTCCC -3'

Sequencing Primer
(F):5'- GGAAGTCGTTCTGAATCCCTTACAG -3'
(R):5'- AGCTTCCCTTAAGAGATGGTATCAGG -3'
Posted On2019-09-13