Incidental Mutation 'R7348:Bmp6'
ID570377
Institutional Source Beutler Lab
Gene Symbol Bmp6
Ensembl Gene ENSMUSG00000039004
Gene Namebone morphogenetic protein 6
SynonymsVgr1, D13Wsu115e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7348 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location38345107-38500302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38485903 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 388 (S388P)
Ref Sequence ENSEMBL: ENSMUSP00000126999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171970] [ENSMUST00000223628]
Predicted Effect probably benign
Transcript: ENSMUST00000171970
AA Change: S388P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126999
Gene: ENSMUSG00000039004
AA Change: S388P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 56 359 2.3e-100 PFAM
low complexity region 368 389 N/A INTRINSIC
TGFB 409 510 6.8e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223628
AA Change: S67P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates a wide range of biological processes including iron homeostasis, fat and bone development, and ovulation. Mice lacking this gene exhibit delayed ossification of the sternum, iron overload, and reduced fertility in females. [provided by RefSeq, Jul 2016]
PHENOTYPE: One homozygous null mutant showed delayed ossification in the developing sternum while females of a second null mutant were smaller than normal in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra G A 15: 41,866,159 R282C probably damaging Het
Adcy2 T A 13: 68,734,675 E314D possibly damaging Het
Adgrl2 A T 3: 148,817,766 I274N Het
Adpgk A G 9: 59,313,786 I292V probably benign Het
Agtrap G T 4: 148,080,597 F124L probably benign Het
Ankrd26 A G 6: 118,508,564 Y1450H probably damaging Het
Ap4e1 A T 2: 127,061,976 S933C probably damaging Het
Ap4e1 G T 2: 127,061,977 S933I possibly damaging Het
Ap5s1 A T 2: 131,212,652 T128S possibly damaging Het
Arih1 T C 9: 59,486,058 Y97C probably damaging Het
Atp1a3 A G 7: 24,978,826 F1034S unknown Het
Ccdc39 A G 3: 33,832,676 V261A possibly damaging Het
Ccdc66 C T 14: 27,500,336 C150Y probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cln6 A G 9: 62,849,176 S201G probably benign Het
Cntnap4 T C 8: 112,665,277 Y125H probably damaging Het
Copa A G 1: 172,102,223 T286A possibly damaging Het
Cul9 A T 17: 46,510,993 I1852K possibly damaging Het
Cyp2j8 C A 4: 96,444,640 A490S probably benign Het
Cyp2t4 A G 7: 27,157,251 I239V probably benign Het
E2f7 C T 10: 110,780,975 T692I probably damaging Het
Fastkd5 A G 2: 130,615,135 Y512H probably damaging Het
Fastkd5 A C 2: 130,616,439 M77R probably benign Het
Fhod3 A G 18: 25,090,467 R957G possibly damaging Het
Gm17018 A G 19: 45,572,466 Y111C probably damaging Het
H6pd C A 4: 149,983,902 probably null Het
Haus5 G T 7: 30,656,966 P544Q possibly damaging Het
Ifi207 CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,196 probably benign Het
Igf2r A G 17: 12,703,484 Y1248H probably damaging Het
Izumo3 T C 4: 92,147,218 N6S possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Map3k8 T A 18: 4,340,561 H251L probably damaging Het
Mapre3 T C 5: 30,861,829 Y6H probably benign Het
Mlh3 G T 12: 85,267,441 P657Q probably damaging Het
Mrgpra1 T C 7: 47,335,409 Y174C probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myh1 C A 11: 67,202,539 P152Q probably damaging Het
Myh6 A T 14: 54,952,259 L1110Q probably damaging Het
Nf1 T A 11: 79,536,850 S1778T probably benign Het
Nkpd1 G A 7: 19,524,416 E707K probably damaging Het
Nlrp4a A G 7: 26,444,273 E21G probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Olfr1354 A G 10: 78,917,562 T241A probably damaging Het
Olfr453 T C 6: 42,744,856 L273S possibly damaging Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr491 T C 7: 108,317,713 V273A possibly damaging Het
Parg G A 14: 32,250,079 R677Q possibly damaging Het
Pcsk5 A T 19: 17,456,818 C1395* probably null Het
Psd2 G A 18: 35,980,336 S287N possibly damaging Het
Psd3 T C 8: 67,790,931 N685S possibly damaging Het
Pygb C T 2: 150,786,983 T39M probably benign Het
Rbfox1 C A 16: 7,408,024 Y351* probably null Het
Rftn1 A G 17: 50,004,323 L396P probably damaging Het
S1pr1 A G 3: 115,712,061 Y295H probably damaging Het
Scn5a T C 9: 119,535,833 M440V probably benign Het
Sel1l2 T C 2: 140,265,724 N240S probably benign Het
Skint1 T C 4: 112,021,573 L234P probably damaging Het
Skint11 T A 4: 114,244,722 Y311N probably benign Het
Slc6a5 A T 7: 49,910,167 probably benign Het
Tas2r134 T C 2: 51,628,402 S298P possibly damaging Het
Tbcd C A 11: 121,594,311 A773D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmem184a T C 5: 139,814,054 E24G probably null Het
Tmem207 C A 16: 26,516,827 W53C possibly damaging Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Ttc37 T C 13: 76,182,884 F1478L possibly damaging Het
Ttc41 G T 10: 86,750,348 E839* probably null Het
Ufd1 T G 16: 18,815,885 probably benign Het
Usp28 A G 9: 49,030,877 E713G probably benign Het
Utrn A G 10: 12,748,018 W159R probably damaging Het
Vcl C T 14: 21,003,150 A411V probably benign Het
Vcl T A 14: 21,008,952 C545* probably null Het
Vmn1r120 A T 7: 21,053,452 S111R probably damaging Het
Wwox T A 8: 114,472,652 C146S probably benign Het
Zbtb2 T C 10: 4,374,574 T57A possibly damaging Het
Zfp362 T C 4: 128,777,217 D336G possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Zfp704 A G 3: 9,474,598 S231P probably damaging Het
Zhx3 G T 2: 160,782,118 S43* probably null Het
Other mutations in Bmp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Bmp6 APN 13 38469634 missense probably damaging 0.99
IGL01409:Bmp6 APN 13 38485889 missense probably damaging 1.00
IGL01646:Bmp6 APN 13 38498928 missense probably damaging 0.99
IGL01823:Bmp6 APN 13 38498822 missense probably damaging 1.00
IGL03000:Bmp6 APN 13 38498911 splice site probably benign
IGL03337:Bmp6 APN 13 38498943 missense probably damaging 1.00
PIT4431001:Bmp6 UTSW 13 38485930 missense probably benign
R1218:Bmp6 UTSW 13 38346250 small deletion probably benign
R1225:Bmp6 UTSW 13 38346281 missense probably benign
R4579:Bmp6 UTSW 13 38469725 missense probably damaging 1.00
R4834:Bmp6 UTSW 13 38485841 missense probably damaging 1.00
R5208:Bmp6 UTSW 13 38469697 missense probably benign 0.23
R5713:Bmp6 UTSW 13 38498952 missense probably damaging 1.00
R5842:Bmp6 UTSW 13 38346567 missense probably damaging 0.99
R6319:Bmp6 UTSW 13 38346414 missense probably benign 0.28
R7565:Bmp6 UTSW 13 38346257 nonsense probably null
R7669:Bmp6 UTSW 13 38484920 missense probably damaging 0.98
R7681:Bmp6 UTSW 13 38346195 missense probably damaging 1.00
R7834:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
R7917:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTGCATTAAAGGACTCCACG -3'
(R):5'- TGGGCTACAGTGCTCTATGG -3'

Sequencing Primer
(F):5'- TTTGCATTAAAGGACTCCACGTCAAC -3'
(R):5'- GGGATCCCATACAGGTTATCTAC -3'
Posted On2019-09-13